Reference no: EM131550566

Question 1. You have crossed true breeding purple peppers (AABB) with true breeding yellow peppers (aabb). The resulting F1 progeny were all purple. When you intercrossed two of the F1 plants, you got the following results: 27 blue 44 purple 9 yellow.

a. Is the color of peppers due to a dihybrid interaction where the homozygous recessive aa, dominant B phenotype is lethal? Perform a chi-square test to determine this.

b. A testcross of a F1 plant to a true-breeding yellow pepper resulted in the following numbers of peppers of each genotype: 8 AaBb, 11 aaBb, 12 Aabb, and 9 aabb. Are the genes that control pepper color linked? Perform a chi-square test to determine this.

c. Given the initial F2 pepper results (27 blue 44 purple 9 yellow), devise an alternative hypothesis (different from the ones tested in parts a and b) for inheritance of pepper color. Perform a chi-square test to determine if your hypothesis should be rejected or not. If your hypothesis was rejected, continue to devise other hypotheses until you have a hypothesis for inheritance that is not rejected by your chi-square analysis.

Question 2. Mary and Bill have two male children. One of their children has a genetic disorder that results in immune system deficiency, while the other child has dwarfism. Neither Bill nor Mary are affected by dwarfism, and neither of them have immune system deficiency.

On Mary's side of the family, her brother has immune system deficiency. Also, Mary's father, mother and maternal grandmother do not have immune system deficiency, but Mary's maternal grandfather does. Additionally, Mary's mother has two brothers and one sister, and none of those siblings have immune system deficiency. Mary's mother's older sister has four children, 2 boys and 2 girls. One of these boys has immune system deficiency but none of the other children do.

On Bill's side of the family, Bill has a younger sister with dwarfism and a younger brother that is not affected. Bill's father was not affected by dwarfism, but his mother does have dwarfism. Bill's mother has a younger brother who also has dwarfism and a younger sister who does not. Finally, Bill's maternal grandfather had dwarfism, but Bill's maternal grandmother did not.

a. Draw a pedigree for Mary's family

b. What is the most likely explanation for the genetic inheritance of immune system deficiency?

c. Draw a pedigree for Bill's family

d. What is the most likely explanation for the genetic inheritance of dwarfism? (Note that your response should agree with your pedigrees and explain any discrepancies that may be seen)

e. If Bill and Mary have another child, what is the probability that this child will have both immune system deficiency and dwarfism?

f. If Bill and Mary's third child does have immune system deficiency and dwarfism, what is the probability that they have that exact set of three children?

Question 3. In mice, genes for albinism (a), chronic inflammation (i), and reduced sense of smell (r) are linked. You initially crossed a mouse that is homozygous dominant for all three traits with a mouse that is homozygous recessive for all three traits. You then crossed several of the resulting F1 offspring to mice that are homozygous recessive for all three traits. You observe the following phenotypes in the offspring:

colored, healthy, normal smell sense	22
albino, chronically inflamed, reduced smell sense	23
colored, chronically inflamed, reduced smell sense	5
albino, healthy, normal smell sense	6
colored, healthy, reduced smell sense	0
albino, chronically inflamed, normal smell sense	1
colored, chronically inflamed, normal smell sense	6
albino, healthy, reduced smell sense	7

a. Diagram a map between the genes and calculate the map distances.

b. If the interference of these genes is 0.43, how many more F2 progeny will you need to observe to see at least 2 of each double recombinant?

c. What are your expected numbers of each single crossover after you have observed the total number of mice calculated in part (b)?

d. If a fourth gene (z) exhibits 54% recombination with gene i, 35% recombination with gene a and 51% recombination with gene r, will this gene be on the same chromosome or a separate chromosome? If gene z is on the same chromosome as the other three genes, indicate its location by copying and modifying your genetic map from part (a).

Question 4. Describe how production of tryptophan is controlled in a bacterial cell. You may use diagrams to assist in your explanation.

a. Describe the organization and function of the tryptophan operon. Describe what happens when tryptophan is absent and what happens when tryptophan is present. Be detailed in your explanations. Include descriptions of the regulatory protein, the state of transcription, and how that transcriptional state was achieved.

b. Describe how the trp operon mRNA that is being transcribed is structurally altered when tRNAs charged with tryptophan are present and how the trp operon mRNA that is being transcribed is structurally altered when tRNAs charged with tryptophan are absent. How do these structural alterations control the continuation of transcription of the trp operon mRNA?

c. Do the processes in parts (a) and (b) occur in eukaryotes? Explain why or why not.

Question 5. Describe and diagram transcription and RNA processing in eukaryotes. Indicate two ways that these processes can result in different mRNAs being produced from a single gene. Be specific about transcription initiation and regulation, and be specific about what modifications are involved in RNA processing and how they occur.

Question 6. In humans, there are two primary types of colorblindness: red/green colorblindness and blue/yellow colorblindness. Red/green colorblindness is a sex-linked recessive trait and blue/yellow colorblindness is a recessive autosomal trait. Approximately 1 in 12 (8%) men and about 1 in 200 (0.5%) women are affected by red/green colorblindness, while approximately 1 in 100,000 people (0.001%) are affected by blue/yellow colorblindness. Fewer than 1 in 1 million people (0.0001%) are affected by both red/green and blue/yellow colorblindness, which results in the complete inability to see color, meaning they can only see shades of grey.

a. Samuel (who is a red/green colorblind man) and Holly (a homozygous normal woman) want to have children. Determine the possible genotypes, phenotypes, and phenotypic frequencies (remember, gender is a phenotype) for their children.

b. One of Samuel and Holly's daughters is heterozygous for the red/green colorblind allele and has children with a man who has normal vision. What are the possible genotypes, phenotypes, and phenotypic frequencies of their children?

c. Nancy and Daniel have normal blue/yellow color vision, but they have a child who is blue/yellow colorblind. What must be true about the genotypes of Nancy and Daniel for this to be possible?

d. Raphael (a blue/yellow colorblind, red/green normal man) and Maria (a heterozygous blue/yellow, heterozygous red/green woman) want to have children. What is the probability of Raphael and Maria having a completely colorblind child? Will this child be male or female?

e. What is the probability of Raphael and Maria having a child with some form of colorblindness (red/green, blue/yellow, or both)?

Question 7. In humans, ABO blood type is controlled by a single gene with 2 codominant alleles (I^A and I^B) and one recessive allele (i). The population of humans in the city of Xanadu is 7568. 1874 of these people have blood type O and 1243 of these people have homozygous blood type A.

a. What are the frequencies of the I^A, I^B, and i alleles assuming this population is randomly mating and there is no significant mutation or natural selection?

b. If a disease suddenly appears that kills 60% of all people with type A blood (leaving 40% alive), kills 40% of all people with type AB blood, kills 10% of all people with type B blood, and kills 5% of all people with type O blood, what is the relative fitness for each blood type (assume the disease continues to kill the same percentages of people each generation)?

c. Using the relative fitness values you calculated in part (b), determine what the allele frequencies of the I^A, I^B and i alleles will be when the population of Xanadu has again reached Hardy-Weinberg equilibrium.

d. This same disease has affected a different human population on the island of Atlantis. This population is smaller and contains 1251 individuals. Of these, 398 are blood type O and 217 are homozygous blood type B. This population has been on the island for many generations, and therefore consists of individuals that are related to each other by descent. The inbreeding coefficient in this island population is 0.08. Assuming that the disease kills the same proportions of people as in part (b), what will be the frequencies of each blood type in this island population when Hardy-Weinberg equilibrium is reestablished?

Question 8. Epigenetic modifications to DNA sequences and resulting alterations in chromatin structure can be analyzed by examining DNA methylation and histone modifications. To examine methylation of a DNA sequence, you treat it with sodium bisulfite.

a. If your original DNA sequence is: ACAGTCCGTCGGAGCCTGCCAGTCGATCGCACCT and your sequence after treatment reads: ACAGTTCGTCGGAGCTTGTTAGTCGATCGCACTT, which positions on the original DNA sequence are methylated? (Indicate methylations with an * after the affected nucleotide)

b. When this DNA sequence is replicated, which of these methylations will be transferred to the new sequence? Indicate what the new sequence will be in the standard 5' → 3' direction.

c. How does an increase in DNA methylation affect chromatin structure and what does this do to gene expression? Be specific.

d. Describe how chromatin structure is altered in the process of X-inactivation and how the active X- chromosome prevents itself from being inactivated. Include the functions of Jpx, Xist, Tsix, and describe what each of these gene products do. Be specific.

Question 9. You are investigating the heritability of tail length in cardinals (red birds). To examine this, you have analyzed tail length in many sets of parents and offspring. A table of this information is below. The following equations may be of use when answering this question:

H² = V_G/V_P ; h² = V_A/V_P ; h² = b ;

V_P = V_G + V_E + V_GE ;

V_G = V_A + V_I + V_D ; R = h²* S.

You may use a graphing program to assist you in answering this question if you wish.

Tail length in Cardinals (measured in cm)
Male parent	Female parent	Offspring
5	5.8	4.8	5.3	4.9	5.2
5.5	4.6	5.3	4.9
4.8	7.2	6.5	5.8	5.9
4.3	4.6	4.4	5.1
5.9	5.5	5.3	5.9
7	6.2	6.9	6.5	5.9	6.2
8.1	6.7	7.5	6.9
7.5	5.9	6.5	5.9	6.3
6.4	6.8	6.8	6.5
6.4	6.4	6.2	6.1	5.9
6.7	7.2	6.8	6.5	7.1

a. Based on this data set, what is the correlation coefficient (r) for inheritance of tail length?

b. Is the correlation coefficient you calculated in part (a) strong or weak? Positive or negative? What does this tell you about the cause-and-effect relationship between parental tail length and offspring tail length?

c. What is the narrow-sense heritability (h2) of tail length?

d. After determining the heritability of tail length, you investigate the response to selection. You determine that the average tail length in the population is 5 cm and you select several birds with longer tail lengths to mate. The average tail length of the birds you selected is 7 cm. What do you expect the average tail length of the offspring of these birds to be?

e. To examine the effects of environmental factors on heritability of tail length, you move several birds to a new location and examine their offspring over several generations. You find that the variance in tail length has increased due to the new environmental conditions. What has this done to the narrow-sense heritability of tail length? Briefly explain your reasoning.

Question 10. Cheryl is a carrier of a Robertsonian translocation between chromosomes 13 and 14. An individual that has three copies of the genetic material on chromosome 13 will be affected by Patau syndrome. Since Cheryl is a carrier, she is normal and does not have Patau syndrome.

a. If Cheryl wants to have children with Stephen (a man who has a normal karyotype), what are the possible karyotypes in their fertilized embryos? (Assume chromosomes 1 through 12, chromosomes 15 through 22, and the X and/or Y chromosomes are normal. You can express your answer in numbers of chromosomes 13, 14, and the 13-14 translocation that would appear in each zygote.)

b. Zygotes that have three copies of the genetic material on chromosome 14 are aborted and zygotes that exhibit monosomy for either chromosome 14 or chromosome 13 are also aborted. If children born with Patau syndrome typically die before the age of 3, what is the probability that Cheryl and Stephen will have a daughter that lives until at least the age of 10?

c. If the daughter from part (b) is a translocation carrier like Cheryl, how many chromosomes does this daughter have in each of his/her somatic cells?

d. Cheryl and Stephen's daughter becomes an adult and attempts to have a child with Matthew. Matthew is heterozygous for a reciprocal translocation between chromosomes 9 and 22, but otherwise has a normal karyotype. What is the probability that a viable zygote will be made by fusion of the male and female gametes? What are the possible karyotypes for this zygote? (Assume chromosomes 1 through 8, chromosomes 10 through 13, chromosomes 15 through 21, and the X and/or Y chromosomes are normal. You can express your answer in numbers of chromosomes 13, 14, 9, 22, the 13-14 translocation, the 9-22 translocation, and the 22-9 translocation that would appear in each zygote.)