Double stranded dna molecule

Reference no: EM1388492

Question: A double stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long.

TACATGATCATTTCACGGAATTTCTAGCATGTA
ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT

a. Which strand of DNA is transcribed and in which direction?
b. Label the 5' and the 3' ends of each strand.
c. In an inversion occurs between the second and the third triplets from the left and right ends, respectively, and the same strand of DNA is transcribed, how long will the resultant polypeptide be?

Reference no: EM1388492

Questions Cloud

Write java program to utilizes gui with five text fields : Write down the program called MaxMinAvgGUI.java which utilizes GUI with five(5)text fields which asks user to enter 5(five) decimal numbers. 1(one)number in each text field.

What is the rims tangential speed : At what speed do a bicycle and its rider, with a combined mass of 100-kg, have the equal momentum as a 1500 kg car travelling at 5 ;{ rm m}/ {rm s}.

Good estimation of the population mean : Use technology to find the estimated minium required sample size. The minimum sample size required is ? Computer users round to the nearest whole number. What is a major obstacle to getting a good estimate of the population mean?

How fast was the car traveling : A car drives straight off the edge of a cliff that is 60 m high. The police at the scene of the accident observed that the point of impact is 134 m from the base of the cliff. How fast was the car traveling while it went over the cliff.

Double stranded dna molecule : A double stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long.

Determine the parental genotypes : Neurospora is a haploid, filamentous fungus normally having fluffy, orange masses of asexual spores called conidia. 2-mutant strains, one having albino conidia,

Select processor or disk for economical view : Similary there is set of disk drives for $7000 which promises two and half times the throughout of your existing disks. Then in economical view whether processor or disk is to select for your computer?

Question about virology : It is January and the starting of a new semester. Just as you get settled in to your new routine, you begin to notice that illness is spreading across campus and other students in your classes are so sick they do not come to virology class.

Explain the difference between phenotype : Assume you are a clinician in a small hospital and are monitoring the progression of myclonic epilepsy in twin boys. One twin remains only mildly affected by the condition.

User Account

All Pages