Double stranded dna molecule

Assignment Help Biology
Reference no: EM1388492

Question: A double stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long.

TACATGATCATTTCACGGAATTTCTAGCATGTA
ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT

a. Which strand of DNA is transcribed and in which direction?
b. Label the 5' and the 3' ends of each strand.
c. In an inversion occurs between the second and the third triplets from the left and right ends, respectively, and the same strand of DNA is transcribed, how long will the resultant polypeptide be?

 

Reference no: EM1388492

Questions Cloud

Write java program to utilizes gui with five text fields : Write down the program called MaxMinAvgGUI.java which utilizes GUI with five(5)text fields which asks user to enter 5(five) decimal numbers. 1(one)number in each text field.
What is the rims tangential speed : At what speed do a bicycle and its rider, with a combined mass of 100-kg, have the equal momentum as a 1500 kg car travelling at 5 ;{ rm m}/ {rm s}.
Good estimation of the population mean : Use technology to find the estimated minium required sample size. The minimum sample size required is ? Computer users round to the nearest whole number. What is a major obstacle to getting a good estimate of the population mean?
How fast was the car traveling : A car drives straight off the edge of a cliff that is 60 m high. The police at the scene of the accident observed that the point of impact is 134 m from the base of the cliff. How fast was the car traveling while it went over the cliff.
Double stranded dna molecule : A double stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long.
Determine the parental genotypes : Neurospora is a haploid, filamentous fungus normally having fluffy, orange masses of asexual spores called conidia. 2-mutant strains, one having albino conidia,
Select processor or disk for economical view : Similary there is set of disk drives for $7000 which promises two and half times the throughout of your existing disks. Then in economical view whether processor or disk is to select for your computer?
Question about virology : It is January and the starting of a new semester. Just as you get settled in to your new routine, you begin to notice that illness is spreading across campus and other students in your classes are so sick they do not come to virology class.
Explain the difference between phenotype : Assume you are a clinician in a small hospital and are monitoring the progression of myclonic epilepsy in twin boys. One twin remains only mildly affected by the condition.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd