Does the pay-for-performance plan seem like a good idea

Assignment Help HR Management
Reference no: EM132750350

Question: Revising the Compensation Scheme One of the first things Rick Rencher wanted to do in his new position at SIL Manufacturing was to improve productivity through teamwork at every level of the company. As the new HR manager, Rick started to change the culture to a team-based approach.

Rick started by installing the concept of team management at the highest level, to oversee the operations of the entire company. The new management team consisted of manufacturing, distribution, planning, technical and human resource managers. Together they developed a new vision for the 500-employee company, which they expressed in the simple phrase "Excellence Together." They drafted a new mission statement for the company that focused on becoming customer driven and team-based, and that called upon employees to raise their level of commitment and began acting as "owners" of the company.

The next step was to convey the team message to employees throughout the company. The communication process went surprisingly well. Rick was happy to see his idea of "workforce of owners" begin to take shape. Teams trained together, developed production plans together, and adopted the technique of 360-degree feedback, in which an employee's performance evaluation is obtained from supervisors, subordinates, peers, and external and internal customers. performance and morale improved, and productivity began to move upwards. The company even sponsored occasional celebrations to reward team achievements and the team structure seemed firmly in place.

Rick decided to change one more thing. The company's long-standing policy had been to give all employees the same annual pay increase. But Rick felt that in the new team environment, outstanding performance should be the criterion for pay raise. After consulting with CEO Trish Safford, Rick sent a memo to all employees announcing the change to team-based pay for performance. The reaction was immediate and 100 percent negative. Employees were not happy with the change.

1. Does the pay-for-performance plan seem like a good idea? Why or why not?

2. What advice will you give Trish and Rick as they consider their decision?

3. What mistakes did they make in adopting and communicating the new salary plan? How might Rick have approached this major compensation change a little differently?

4. Assuming the new pay plan was eventually accepted, how will you address the fact that in the new performance evaluation system, employees' input affected their peers' pay levels?

Reference no: EM132750350

Questions Cloud

Discuss effective application of the given hr practices : There are several strategies for job redesign such as job rotation, job enlargement and job enrichment. Discuss effective application of these HR practices.
Give Thrasher journal entries to record events : Thrasher Construction Co. was contracted to construct a building for $975,000. Give Thrasher's journal entries to record these events
Presentation adjustments affects how the data is displayed : Kirk (2016) tells us that data adjustments affects what data is displayed and presentation adjustments affects how the data is displayed.
Describe the normal process of signal transmission : Explain how the signal transmission at a synapse in an individual with Parkinson's disease is different than an unaffected individual.
Does the pay-for-performance plan seem like a good idea : Revising the Compensation Scheme One of the first things Rick Rencher wanted to do in his new position at SIL Manufacturing was to improve productivity through.
Prepare the journal entries on the books of stellar corp : Prepare the journal entries on the books of Stellar Corporation. On January 1, 2020, Stellar Corporation purchased a newly issued $1,300,000 bond.
Organizations are struggling to reduce : Organizations are struggling to reduce and right-size their information foot-print, using data governance techniques like data cleansing and de-duplication.
How dose renewable resources help with climate change : How dose renewable resources help with climate change compared to non renewable resources?
Identify the new strand of dna that would be produced : Using the DNA strand CCTTAAGGGATCACGTGGAATCAC, reading from the left, consider the impact of the second T(thymine) is mistakenly replicated as cytosine

Reviews

Write a Review

HR Management Questions & Answers

  Flexible benefits program

Conduct online research and choose an organization, public or private, that has gained popularity because of their flexible benefits program or lack thereof - Many organizations, both public and private, use flexible benefits programs to help attr..

  What factors have led to an increased interest in hr metrics

Based on the video and your readings this week, please respond to the following question: What factors have led to an increased interest in HR Metrics and Workforce Analytics in recent times

  Discuss the problems of on-the-job training

The most common type of training at all levels of an organization. Discuss the problems of on-the-job training that should be taken into consideration.

  Identify the chosen training and strategy topic

Explain how the real-world situation clarifies or exemplifies the concepts in your selected topic, providing supportive examples and credible evidence as needed. Explain how training and strategy can align with organizational objectives.

  Discuss three policy strategies would implement

Discuss three policy strategies you would implement and practice to minimize personal risk while simultaneously ensuring your organization is in compliance

  Discuss about the new reward and recognition program

As an HR manager in a large healthcare organization, you have developed a new reward and recognition program designed to help increase employee motivation.

  Discuss the basic motivational process and the core phases

View this video clip of the film Apollo 13. Enter the pasword orgbehavior to play it.In chapters seven through ten several OB topics were examined. As you review the video, look for incidences that relate to OB concepts that you observe.

  Reviewing work and formatting stylesall students should

reviewing work and formatting stylesall students should answer the following discussion question and post the response

  How many compensable injuries happened last year

Discuss how many compensable injuries happened last year. Explain how many incidents and how much and what could happen if the workforce doubled.

  Write down a 1400- to 1750-word paper describing the role

select and watch one of the following moviesbulllegally blonde 2001 pg-13bulllove actually 2003 rbullbrick lane 2007

  Discuss the different types of harassment

Discussion of different types of harassment. Discussion of the Occupational Safety and Health Act (OSHA). Discussion of the Family Medical Leave Act (FMLA). A team-building activity that addresses one of the topics in the presentation.

  Detailed explanation to affirmative action1 summarize the

detailed explanation to affirmative action1. summarize the influences of diversity within a workplace.2. show the

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd