Discuss whether the decision to build the factory

Assignment Help Other Subject
Reference no: EM133208929

Question - ABC Sdn Bhd is one of the largest pharmaceutical companies in Malaysia with the aim and vision to provide Malaysians with the best affordable generic medicines. Generic medicines provide the same clinical benefits and effectiveness as the branded ones, but the generic ones can be purchased at a much lower price. To fulfill the vision of ABC Sdn Bhd, the company had built a factory/ plant at Kampung Melur beside the Melur River. The Melur River is the natural habitat for fish and wildlife such as freshwater catfish, bass, and other endangered species as well as source of food for the residents of Kampung Melur. Recently, the residents of Kampung Melur discovered a mountain of dead fish and other wildlife at the Melur River. In addition, some residents who have been consuming the water and fishes caught at the Melur River became ill. They suspected that it was due to the toxic pollution discharged from ABC Sdn Bhd factory.

With reference to the above scenario, discuss whether the decision to build the factory at Kampung Melur is considered as ethical or unethical by applying Utilitarianism and Kantian Theory.

Reference no: EM133208929

Questions Cloud

How does chronic hypoxemia lead to polycthemia : How does chronic hypoxemia lead to polycthemia and What effects do hypoxic vasoconstriction and polycythemia have on the circulatory system
How many cells were plated on all 4 plates : How many cells were plated on all 4 plates? How many colonies total? Thus how many DNA molecules were able to transform those cells
Write a set of at least four ethical behaviours : Write a set of at least four ethical behaviours that you intend to abide by in your work as a real estate agent, based on your knowledge
What secondary structure is typically bound : What secondary structure is typically bound by the translocon during co-translational transport but is not cleaved by a signal peptidase
Discuss whether the decision to build the factory : Discuss whether the decision to build the factory at Kampung Melur is considered as ethical or unethical by applying Utilitarianism and Kantian Theory
Explain the evidence for evolution : Explain the evidence for evolution? What evidence did Darwin use to explain his theory of evolution? What do we know today that we didn't know then
Discuss the main dimensions for classification : Discuss the main dimensions for classification of networked e-business. Discuss the main business directions and operations related to networked e-business
What amino acid sequence will be generated : What amino acid sequence will be generated based on this strand of DNA? Use Figure 16.6 in your text book 3TACCGCTTACTGAAAGTTATT
Advise jackie on the sale of the farm house : The second issue she is having is regarding a rental property that she owns. Advise Jackie on the sale of the farm house

Reviews

Write a Review

Other Subject Questions & Answers

  Foundation of intelligence testing

What should be the foundation of intelligence testing? Please discuss the original definition of intelligence as suggested by Binet, including the intelligence quotient (IQ) that is the result of this theoretical construct.

  Clarify the quantitative analysis project

Using what you have researched and studied throughout Modules 1 - 7, write a report addressing a quantitative analysis (QA) project. Please provides at least three mathematical examples supporting your recommendations.

  Hardware and software paper

Write a 2-3 page paper describing the hardware and software used to support personal, workgroup, and enterprise computing within your current organization, an organization with which you are familiar, or an organization that you can interview to g..

  Conduct a general survey and a health history

General appearance: Gender. Apparent age. Ethnic group. Does client appear healthy. Note general color of skin and general hygiene

  Opportunity to pull from all of the concepts presented

The purpose of this lab is to allow students with the opportunity to pull from all of the concepts presented in the course and be able to construct a circuit for a real time industry application. This lab will showcase all that was learned in the ..

  Justine victimization at the parent-teacher conference

Create a three-item agenda to discuss how to handle Justine's victimization at the parent-teacher conference.

  Provide technical information to a client regarding an its

For this item, put yourself in the mindset of a consultant looking to provide technical information to a client regarding an ITS deployment, but at a level the client will be able to understand.

  What are the biological aspects of criminal behavior

It is often unpopular to discuss genetic and biological aspects of criminal behavior. In our culture we tend to focus on choice or on the offender's environment

  Explain the major causes of stress for law enforcement

Explain the major causes of stress for law enforcement personnel and the impact the stress may have on the professional and personal life of officers.

  Describe characteristics of a culturally responsible tourist

Describe any two characteristics of a culturally responsible tourist Outline the five types of cultural tourists as proposed by McKercher and Du Cros (2002)

  Why is are intellectual property laws so important

Why is are intellectual property laws so important? Do you think they are important or should be do away with these laws? What are patents and how are they used

  How state board control advanced practice through regulation

Visit your state board of nursing website and/or contact the board to determine how the state board controls advanced practice through regulations.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd