Difference between intermediate host and definitive host

Reference no: EM1395854

Question: Studying the genome of that same cell, the scientist discovers the following sequence. She is keen to identify which possible proteins could be coded for by this sequence. To qualify as a legitimate answer, the proteins must contain the N-terminal amino acid methionine, but need not go all the way to the C-terminal stop codon.
5'TCTATCCATGTACCACTGGATGCGGTAAATCCCTAGGCAT3'
3'AGATAGGTACATGGTGACCTACGCCATTTAGGGATCCGTA5'

1. Methionine-Tyrosine-Histidine-Tryptophan-Methionine-Arginine
2. Methionine-Proline-Arginine-AsparticAcid-Leucine-Proline-Histidine-Proline-Valine- V aline-Histidine-Glycine
3. Methionine-Valine-Threonine-Tyrosine-Alanine-Isoleucine
4. Serine-Isoleucine-Histidine-Valine-Proline-Leucine-AsparticAcid-Alanine-Valine- Asparagine-Proline

Question: What is the difference between an intermediate host and a definitive host? Identify each host in the life cycle of the causative agent of malaria?

Reference no: EM1395854

Questions Cloud

Confidence interval-average ages for the viewers : Construct a 99% confidence interval on the difference of the average ages for the viewers of the two TV programs. How can you interpret this interval?

Describe the two types of rna editing : Describe the two types of RNA editing, outlining the different steps involved. Which type of editing involves the most significant changes in the mRNA sequence?

Compare the spliceosome to the ribosome : Compare the spliceosome to the ribosome. What general features do they share in terms of their structure, their components, and their activity? How do they differ?

Mean number of production units for two shifts : Find a 90% confidence interval on the difference in the mean number of production units for the two shifts.

Difference between intermediate host and definitive host : What is the difference between an intermediate host and a definitive host? Identify each host in the life cycle of the causative agent of malaria?

How newborn infants contract mrsa : MRSA has at last surpassed HIV/AIDS in numbers of related deaths in U.S. What is meant by Staphylococcus aureus?

Competing for customers : First National Bank and City National Bank are competing for customers who would like to open IRAs. 32 weeks are randomly selected for First National Bank and another 32 weeks are randomly selected for City National.

Purpose-interpretation of multiple regression analysis : What purpose does a multiple regression analysis serve? Give an example of how it might be used in marketing research.

Random set of married and single men : A marketing firm asked a random set of married and single men as to how much they were willing to spend for a vacation. At *alpha*= .05, is a difference in the two amounts?

User Account

All Pages