Determine the expected number of empty bins

Assignment Help Basic Computer Science
Reference no: EM1368354

Suppose that n balls are tossed into n bins, where each toss is independent and the ball is equally likely to end up in any bin. What is the expected number of empty bins? What is the expected number of bins with exactly one ball? For large n, the probabilty expression can be simplified with a term having the base of natural logarithm, e. (hint: try to find the probability that, some bin, say j is empty (or have exactly one ball))

Reference no: EM1368354

Questions Cloud

Define recently company has experienced issues with employee : Explain Recently your company has experienced issues with employee teamwork. Employees are not working well together. Your boss has asked you to research ways to create an effective team work environment.
Explain elements of enterprise information security policy : Write and explain briefly the three kinds of information security policy as described by NIST SP 800-14. Write and explain briefly four elements that must be present in Enterprise Information Security Policy.
Calculate opportunity cost of increasing the annual output : Atlantis is a small, isolated island in South Atlantic. The  inhabitants increase potatoes and catch fresh fish. The accompanying  table shows the maximum yearly output combinations  of potatoes and fish that can be produced.
Problems on advanced computer networks : Identify and explain the events that can change the state of the system also determine the percent of time that this storage space will be adequate to accommodate newly arrived jobs-CS524 Advanced Computer Networks
Determine the expected number of empty bins : Assume that n balls are tossed into n bins, where each toss is independent and ball is equally likely to end up in any bin. Determine the expected number of empty bins?
Compute the npv and irr on properties : Compute the NPV and IRR on each of these properties individually and collectively assuming a discount rate of 15 percent
Determine the cost function : Manchester Foundry produced 45,000 tons of steel in March at a expenses of $1,150,000. In April, foundry produced 35,000 tons at a cost of $950,000.
Question on first degree price discrimination : Two consumers, Consumer 1 and 2, purchase the same product. Compute the prices that should be charged to each customer if the seller is able to use first degree price discrimination.
Determine independent variable and dependent variable : The length of the string is shortened by 5cm and the time is measured. Determine the independent variable? Determine the dependent variable? What must the controlled variables be?

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Intelligent systems for health maintenance organization

Aacquiring a company in the health maintenance organization (HMO) field. DSS, ES, ESS, or intelligent systems can be used in such a situation.

  Explaining benefits of reconnaissance tools

Write down some popular reconnaissance tools? Compare three reconnaissance tools and describe the benefits and limitations of each.

  Identify potential weaknesses of quality web design company

Identify potential weaknesses from either the Aircraft Solutions or Quality Web Design Company. In this phase, you will choose either Aircraft Solutions or Quality Web Design as the company you will work with.

  How many units of each component ordered from each supplier

If the Edwards production plan for the next period includes 1000 units of component 1 and 800 units of component 2, how many units of each component (C1, C2) should be ordered from each supplier (S1, S2, S3)?

  Techniques in discovering requirements for a system

What are some of the techniques in discovering requirements for a system? Which ones work best? Which ones are the most economical?

  Discuss strategies to dilute manager-s anger

Discuss strategies you will use to dilute this manager's anger. Discuss how you will get them both to support your recommendations.

  List five addressing modes of the lc

What is an addressing mode? Name three places an instruction's operands might be located. List five addressing modes of the LC-2.

  Explaining actionscript developer

What do you believe the following comment means for ActionScript developer: "you are used to having to define object methods and properties in class structure before using them in instance.

  Design robot that can perform any function or activity

Design a robot that can perform any function or activity you choose from an automatic laundry robot to a customer service robot.

  Explain delimiter marks only beginning of comment

Delimiter marks only the beginning of the comment (for one line comments). Write the advantages and disadvantages of each of these with respect to our criteria.

  Relationship between squared biases and variances

Assume we have sample of N pairs xi, yi drawn i.i.d. from distribution characterized as given: xi ∼ h(x), design density. Illustrate relationship between squared biases and variances.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd