Determine the count of each nucleotide in the sequence

Assignment Help Computer Engineering
Reference no: EM132211198

Question :

Write a program that will read a DNA or RNA sequence in FASTA format and determine the count of each nucleotide in the sequence. Your task is to write such a program as a Perl script

The Perl script should

- work with FASTA files containing only one sequence

- The name of the file can be given on the command line when the script is invoked. If the name of the FASTA file is not specified on the command line, the script will read the sequence information (in FASTA format) from the standard input

- The script is to confirm that the record is in FASTA format. If it is not, it is to issue an error message and terminate

- Sequence information in the FASTA file can be in upper or lower case

- Output information is to be prefaced by the sequence identifier from the FASTA header

Notes:

To loop through the characters of a string you can use a construction such as

while( $c = ( chop $str ) )

For example

Given a FASTA file with content such as

>441E-590 Nov_16c/Nov16c/441E-590.SEQ trimmed vector-stripped GCGTCGACGTTCTACGACACGTCGTGCCCCAGGGCTCTGGCCACCATCAAGAGCGGCGTG GCGGCAGCCGTGAGCAGCGATCCCCGCATGGGCGCCTCCCTGCTCAGGCTGCACTTCCAC GACTGCTTTGTCCAAGGCTGTGACGCGTCTGTTCTTCTGTCCGGCATGGAACAAAACGCG GGCAAACAACCAAACCTTGGNCGNAACCNTGGGAACACNNANCGAACGCCCCCAAANGGC GTTTTCNGAACAAAACGGCCCTTNACTTNCAACCCAAAACCCTTCCCTTGGTCAACAAAA AAAAAANGGGGGNTTCCCCTTGGGNAACTTCGNGGAAANCCAAANGGNGGGGTTTCTTTT AAAAACAAAC
your output should look like

inventory for '441E-590' : A: 89 C: 111 G: 89 T/U: 64 other characters: 17 Do not include newline or carriage-return characters in any of your counts.

Reference no: EM132211198

Questions Cloud

Write a program prompts the user to enter a number : Write a program prompts the user to enter a number between 5 and 10. Then prompt them to enter that many numbers.
The supply chain is the heart of company operations : The supply chain is the heart of a company’s operations. To make the best decisions, managers need access to real-time data about their supply chain,
Print or display the computed day of the year : Write a program in Python that computes the sequential day of the year (365 or 366).
Display the number of days in the specified month : Display the number of days in the specified month of the specified year. The outputs should be descriptive and friendly to end users.
Determine the count of each nucleotide in the sequence : Write a program that will read a DNA or RNA sequence in FASTA format and determine the count of each nucleotide in the sequence.
Write a program in python that checks if a word supplied : Write a program in python that checks if a word supplied as the argument is an Isogram. An Isogram is a word in which no letter occurs more than once.
Create labels for onetime advertising promotion : Suppose that the vice president of marketing asks you to write a program to create labels for a onetime advertising promotion.
What benefits did coca-cola gain from the investment : What are the two reasons why Coca-Cola is able to account for Monster Beverage Corporation Monster Transaction using the equity method?
Calculate the total resistance assuming the resistors are : Write a program that queries the user for two resistor values and then calculates the total resistance assuming the resistors are in series.

Reviews

Write a Review

Computer Engineering Questions & Answers

  Mathematics in computing

Binary search tree, and postorder and preorder traversal Determine the shortest path in Graph

  Ict governance

ICT is defined as the term of Information and communication technologies, it is diverse set of technical tools and resources used by the government agencies to communicate and produce, circulate, store, and manage all information.

  Implementation of memory management

Assignment covers the following eight topics and explore the implementation of memory management, processes and threads.

  Realize business and organizational data storage

Realize business and organizational data storage and fast access times are much more important than they have ever been. Compare and contrast magnetic tapes, magnetic disks, optical discs

  What is the protocol overhead

What are the advantages of using a compiled language over an interpreted one? Under what circumstances would you select to use an interpreted language?

  Implementation of memory management

Paper describes about memory management. How memory is used in executing programs and its critical support for applications.

  Define open and closed loop control systems

Define open and closed loop cotrol systems.Explain difference between time varying and time invariant control system wth suitable example.

  Prepare a proposal to deploy windows server

Prepare a proposal to deploy Windows Server onto an existing network based on the provided scenario.

  Security policy document project

Analyze security requirements and develop a security policy

  Write a procedure that produces independent stack objects

Write a procedure (make-stack) that produces independent stack objects, using a message-passing style, e.g.

  Define a suitable functional unit

Define a suitable functional unit for a comparative study between two different types of paint.

  Calculate yield to maturity and bond prices

Calculate yield to maturity (YTM) and bond prices

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd