Determine the count of each nucleotide in the sequence

Assignment Help Computer Engineering
Reference no: EM132211198

Question :

Write a program that will read a DNA or RNA sequence in FASTA format and determine the count of each nucleotide in the sequence. Your task is to write such a program as a Perl script

The Perl script should

- work with FASTA files containing only one sequence

- The name of the file can be given on the command line when the script is invoked. If the name of the FASTA file is not specified on the command line, the script will read the sequence information (in FASTA format) from the standard input

- The script is to confirm that the record is in FASTA format. If it is not, it is to issue an error message and terminate

- Sequence information in the FASTA file can be in upper or lower case

- Output information is to be prefaced by the sequence identifier from the FASTA header

Notes:

To loop through the characters of a string you can use a construction such as

while( $c = ( chop $str ) )

For example

Given a FASTA file with content such as

>441E-590 Nov_16c/Nov16c/441E-590.SEQ trimmed vector-stripped GCGTCGACGTTCTACGACACGTCGTGCCCCAGGGCTCTGGCCACCATCAAGAGCGGCGTG GCGGCAGCCGTGAGCAGCGATCCCCGCATGGGCGCCTCCCTGCTCAGGCTGCACTTCCAC GACTGCTTTGTCCAAGGCTGTGACGCGTCTGTTCTTCTGTCCGGCATGGAACAAAACGCG GGCAAACAACCAAACCTTGGNCGNAACCNTGGGAACACNNANCGAACGCCCCCAAANGGC GTTTTCNGAACAAAACGGCCCTTNACTTNCAACCCAAAACCCTTCCCTTGGTCAACAAAA AAAAAANGGGGGNTTCCCCTTGGGNAACTTCGNGGAAANCCAAANGGNGGGGTTTCTTTT AAAAACAAAC
your output should look like

inventory for '441E-590' : A: 89 C: 111 G: 89 T/U: 64 other characters: 17 Do not include newline or carriage-return characters in any of your counts.

Reference no: EM132211198

Questions Cloud

Write a program prompts the user to enter a number : Write a program prompts the user to enter a number between 5 and 10. Then prompt them to enter that many numbers.
The supply chain is the heart of company operations : The supply chain is the heart of a company’s operations. To make the best decisions, managers need access to real-time data about their supply chain,
Print or display the computed day of the year : Write a program in Python that computes the sequential day of the year (365 or 366).
Display the number of days in the specified month : Display the number of days in the specified month of the specified year. The outputs should be descriptive and friendly to end users.
Determine the count of each nucleotide in the sequence : Write a program that will read a DNA or RNA sequence in FASTA format and determine the count of each nucleotide in the sequence.
Write a program in python that checks if a word supplied : Write a program in python that checks if a word supplied as the argument is an Isogram. An Isogram is a word in which no letter occurs more than once.
Create labels for onetime advertising promotion : Suppose that the vice president of marketing asks you to write a program to create labels for a onetime advertising promotion.
What benefits did coca-cola gain from the investment : What are the two reasons why Coca-Cola is able to account for Monster Beverage Corporation Monster Transaction using the equity method?
Calculate the total resistance assuming the resistors are : Write a program that queries the user for two resistor values and then calculates the total resistance assuming the resistors are in series.

Reviews

Write a Review

Computer Engineering Questions & Answers

  Compare and contrast sdlc and two other development models

Compare and contrast SDLC and 2 other development models. What differences or similarities do you see between your posting and other classmates' postings?

  Create a functions that has the customer_id as input

Create a functions that has the Customer_id as input and returns a number that represents the total cost of orders for this customer.

  Two-way set-associative cache for a main memory

Determining the Tag, Line, and Word values for the Direct-mapped, associative, and two-way set-associative cache for a main memory address of EEEEEE.

  List and describe the ways to backup the registry

Describe the Windows kernel, including its two main components and list and describe the ways to backup the registry.

  Create an outline for the completed risk management plan

Develop and provide an introduction to the plan by explaining its purpose and importance. Create an outline for the completed risk management plan.

  Displays several dimensions with a single plot

Use your imagination to develop your own data visualization that displays several dimensions with a single plot. (For example, color of data points can be used to categorize one dimension.

  Why the program should consist of two files

When you input two strings representing your first and last names, have the program output your initials. The program should consist of two files, Initials.java and InitialsApp.java. Comment the code.

  Identify a minimum of three is or it applications

demonstrate factual knowledge, understanding and the application of technology related issues. identify a minimum of three IS or IT applications.

  What attributes would you require to explain an entity

what attributes would you need to describe an entity called video for a video store? also what would you use as the

  Write a code to delete the first node in the list

Write C++ code to insert the node pointed to by newptr after the node pointed to by predptr.

  Design a structure in which the order of polling specified

The structure of Figure polls the peripheral devices in the order of the device numbers. Design a structure in which the order of polling (i.e., priorities).

  Why you use the parts you used

List all the components that you will use - Be sure to give specifics about the brand/model, cost and specs and justify why you use the parts you used.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd