Determine pz and also estimate any constants

Assignment Help Basic Computer Science
Reference no: EM1371076

Consider an M/M/1 queueing system with parameters  and μ. At each of the arrival instants one new customer will enter the system with probability 1/2, or two new customers will enter simultaneously with probability 1/2.

(a) Draw the state-transition-rate diagram for this system.
(b) Write down the equilibrium equations for Pk.
(c) Find P(z) and also evaluate any constants in this expression so that P(z) is given in terms only of  and μ. If possible eliminate any common factors in the numerator and denominator of this expression (this makes life simpler for you in part (d)).
(d) From part (c) find the expected number of customers in the system.

Reference no: EM1371076

Questions Cloud

What is the kinetic energy of electron in electron volts : A jetliner, traveling northward, is landing with a speed of 65m/s. Once the jet touches down, it has 715 m of runway in which to reduce its speed to 6m/s
What net force is acting on the mass along the incline : A small steel ball bearing with a mass of 17g is on a short compressed spring. When aimed vertically and suddenly free, spring sends the bearing to a height of 1.33 m. compute the horizontal distance ball would travel if the same spring were aimed..
Illustrate what way might society gain if fed implements : Illustrate what way might society gain if Fed implements policy you have proposed instead of simply permitting long-run adjustments to take place.
What is the length of a pendulum whose period on the moon : A child in a boat throws a 3.50 kg package out horizontally with a speed of 15m/s. Calculate the velocity of the boat immediately after, assuming it was initially at rest. The mass of the child is 25kg and that of the boat is 70kg. Ignore water re..
Determine pz and also estimate any constants : Determine P(z) and also estimate any constants in this expression so that P(z) is given in terms only of  and μ. If possible eliminate any common factors in numerator and denominator of this expression
Explain about publishing methods : To Self-Publish or to Not Self-Publish - The internet is taking some of this influence away
Illustrate what is total subsidy that firm receives : Illustrate what is total subsidy that firm receives at this optimal level of emissions? total abatement cost of firm at optimal level of emissions.
Question of monetary multiplier : Suppose if 100$ million in excess reserves are made available to banking system, by how much can the banking system increase the money supply?
What is the acceleration of gravity at the location : If the highest acceleration the vehicle's brakes are capable of is -5 m/s2, what is the maximum reaction time of motorist that will allow her or him to keep away from hitting the deer.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Describe areas where you see disagreement between authors

Include any information you believe adds to the material in the text. Describe any areas where you see disagreement between the two authors.

  Explain specific challenges of facing designer

Explain specific challenges of facing the designer, specifically with regard to limitations of hardware, software and interface design two paragraph each.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Find the gradient magnitude and gradient direction

Consider the sub-image shown above. Find the gradient magnitude and gradient direction at the center entry using the following operators.

  Describe tttc management significance of observing user

Using at least two articles for support, describe to TTTC management the significance of observing user reaction, suggestions, and innovations in prototyoping process.

  What was business impact of tjx-s data loss on tjx

What was the business impact of TJX's data loss on TJX, consumers and banks and how effectively did TJX deal with these problems?

  Explain the concept of supply chain management

Explain the concept of supply chain management. Although R/Way offers services rather than products, could that concept apply to the design of R/Way's new system? If so, how?

  Explain decrease in memory cost and push to keep data

Explain the apparent contradiction between the decrease in memory cost and the push to keep a single copy of Explain decrease in memory cost and the push via the paradigm of deduplication.

  Calculate overall cost including installation-configuration

Calculate the overall cost, including installation, configuration, maintenance, ISP, and miscellaneous costs. Do not consider depreciation in the cost computation.

  Explaining geographical information systems

Considering this, explain in scholarly detail some suitable examples of geographical information systems and how they are utilized in supporting both marketing and sales.

  How cost of box is evaluated in lookup table

Cost of box is determined by looking up value in a lookup table. Shipping cost also is determined by looking up value in a lookup table. Use table at cells H23:J28 with a VLOOKUP function to determine cost of a box.

  Website has a duty to be familiar with drug laws

Assume a foreign website sells drugs which are not approved by regulatory agencies for sale to citizens of another country. Do you believe that website has a duty to be familiar with drug laws throughout the world?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd