Describes the type of mutation observed

Reference no: EM13530090

The two sequences below represent a normal and a mutated form ofmRNA. Which of the following statements best describes the type of mutation observed?

Normal 5' AUGCCAGCCAGCCCUUCCAGA 3'
Abnormal 5' AUGCCAGCCAGCCCUUCUAGA 3'

a) Point , Silent
b) Point , Missense
c) Point, Nonsense
d) Frame-shift , Insertion
e) Frame-shift, Deletion

Reference no: EM13530090

Questions Cloud

Double-stranded DNA is a cylinder : Double-stranded DNA is a cylinder that is 20A wide and 3.4A longper base pair. E. coli chromosome is a single double-stranded molecule that is 4.6 million bplong.

In fruit flies the gene for black body : In fruit flies the gene (b) for black body is recessive to itsallele for gray. The gene (h) for hairy body is recessive for itsallele for wild type. A gray, wild-type female was crossed with ablack, hairy male.

In drosophila the gene for vestigial wing : In drosophila the gene (vg) for vestigial wing is a recessivelocated at 67.0 units from the left end of the second chromosome.The gene (cn) for cinnabar eyes is also recessive and is located at57.0 units from the left end of the chromosome.

In fruit flies the gene for yellow body : In fruit flies the gene (y) for yellow body is sex-linked (inthe first chromosome) and recessive. Bar eye is produced by asex-linked dominant gene (B). The gene (Cy) for curly wings isdominant located on the second chromosome. The gene (Pm) for pl..

Describes the type of mutation observed : The two sequences below represent a normal and a mutated form ofmRNA. Which of the following statements best describes the type of mutation observed?

Is hairy pinna a sex linked disease : Is hairy pinna a sex linked disease? If a man has hairy pinna has a normal sister but a brother withhairy pinna too. Give the genotypes of all these individuals andthe possible genotypes and phenotypes of the parents.

Is bractyldactly a sex linked or autosomal disease : A woman who is colour blind and has bractyldactly marries aman who is not colourblind and does not have bractyldactly. If thecharacteristic bractyldactly is dominant to the recessive conditionand you know thta the woman's mother did not have thisc..

What are the genotypes of the parents : What are the genotypes of the parents if a colour blind man hasa normal sister and a colour blind brother. (Use Punetts square ifnecessary) A haemophiliac father has a haemophiliac son. Give the mostprobable genotypes of the parents and the child.

What is the advantage of reproducing by seed : What is the ploidy of the gametophyte and the sporophyte? Which generation is the one we associate with a moss plant? How many domains does insulin have? What is the advantage of reproducing by seed?

User Account

All Pages