Reference no: EM133413406
Questions
1. You are interested in a human enzyme telomerase. For your project you will need to use PCR to amplify a fragment of the coding sequence of the telomerase gene below. 5' GCGCTGCGTCCTGCTGCGCACGTGGGAAGCCCTGGCCTAGTC 3' Design a forward and reverse primer to amplify the sequence provided. You will need 6-nucleotide long primers. Their sequences should be: A. 5' _________________________________3' and B. 5'_________________________________3' 2
2. Describe the process of creating a genetically modified animal. Describe every step in the process from obtaining the DNA to putting it in an animal cell and growing a new genetically modified animal. Provide an example of a transgenic animal. A minimum of four sentences is required . A Viral capsid is made up of ______________ while a viral envelope is made up of _____________________________________.
a. Protein, plasma membrane b. Protein, DNA c. RNA, protein d. DNA, protein
4. Describe how HIV infects cells, Answer the following questions in complete sentences. Use the diagram of HIV for reference. What type of cells does the virus infect? How does HIV infect a cell? How does HIV transmit itself into a host cell? How does HIV replicate? How does HIV assemble new virus particles? and leave the host cell to infect another cell.
5. Give two examples of genetically modified animals (livestock) that we have discussed in class. Describe briefly the purpose of the modification (i.e. how do these transgenic animals vary from wild types?.
6. List one advantage and one disadvantage of using Y chromosome analysis in forensics. Advantage: ________________________________________ Disadvantage: __________________________________________
7. Describe the process of creating a genetically modified plant using Agrobacterium tumeficians. Describe every step in the process from obtaining the DNA to putting it in a plant cell and growing a new genetically modified plant. Provide an example of a transgenic plant. A minimum of four sentences is required for the answer.
8. List the ingredients of PCR. In other words, what do you need to put in your tube for a successful PCR?
9. You are trying to sequence a short fragment of DNA. You have performed a sequencing reaction with fluorescently labeled dideoxyribonucleotides. After separation you obtained DNA fragments of different lengths with the following bases at the ends (marked with a *): T* xxxxxxT* xA* xxxxxG* xxA* xxxC* xxxxxxxC* xxxxG* For example, "xxA" means a 3-nucleotide-long fragment with dideoxy-A at the end. "x" means any nitrogenous base but you only know precisely which base is at the end of each fragment. A.From the fragments above deduce the sequence of the PCR product. 5'_______________3' B.Write the corresponding DNA sequence 3'___________________5' C.Report the DNA sequence in 5'-3' orientation. 5'__________________3'.