Define static binding and dynamic binding

Assignment Help Basic Computer Science
Reference no: EM13208543

1. Define static binding and dynamic binding and give an example of each. Static binding occurs at compile time and dynamic binding occurs at run time. 2. Describe a situation when a history sensitive variable in a subprogram is useful.

Reference no: EM13208543

Questions Cloud

Define the bond dipoles of iodomethane : Write a brief discussion of the bond dipoles of iodomethane and the corresponding Grignard reagent.
Determine what is the annual equivalent expense : Major overhaul express of $5000 each are anticipated for a large piece of earthmoving equipment. The expenses will occur at EOY four and will continue every 3 years thereafter up to and including year 13. The interest rate is 12% per year.
Write a python programs to solve : Write a Python programs to solve the following. Scientist measure an object's mass in kilograms and its weight in newtons. The equation is weight = mass * 9.8.
Explain what is the maximum number of electrons : Assuming that the Pauli exclusion principle remains valid in the distant universe, what is the maximum number of electrons that can populate a given orbital there.
Define static binding and dynamic binding : 1. Define static binding and dynamic binding and give an example of each. Static binding occurs at compile time and dynamic binding occurs at run time. 2. Describe a situation when a history sensitive variable in a subprogram is useful.
What is the effective annual interest rate : Your credit union is willing to lend you $32,000 for your home remodeling project. You must sign a home equity loan that requires you to make payments of $395.00 at the end of each month for the next 10 years.
Determine if that polygon is a square : Given the length of four sides determine whether they can be used to create a polygon and determine if that polygon is a square. A polygon can be created if no single side is greater than the sum of the other three sides.
State the envrionmental hazards that come from poultry farms : Discribe in DETAIL, the envrionmental hazards that come from poultry farms?
Briefly mention the set of ai-based rules : You are to develop AI behind a generic Tic-Tac-Toe game, where a player can pay against computer. Briefly mention the set of AI-based rules that have to check on either side to decide the next move in a game. How would you determine a winner/cat's..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Describing problems with information systems management

Describe at least three issues/problems with Information Systems Management (ISM) in a named organization.

  Identify organizations that may be susceptible to each type

Identify organizations that may be susceptible to each type of attack and explain what the perpetrators might hope to gain by infiltrating their systems.

  What is the new functionality

What are the main concepts and metaphors that have been used for each and what is the new functionality

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Design circuit buffer last-in first-out lifo

I want design circuit this Buffer(LIFO). This blocking is for FIFO memory but i want design circuit Buffer Last-in First-out LIFO 4*4

  Finding content of ac and memory word at specified address

What are the content of the AC and the memory word at address 103 when the computer halts.

  How many register window should be saved to memory as result

Assume two more calls are made after the maximum value from part (a) is reached. How many register windows must be saved to memory as a result?

  Make a c program using cramers rule using 3 variables and eq

make a C program using cramers rule using 3 variables and 3 equations. I need help why the third variable says it isnt initialized and allow the the determinents to be calculated. also i need help making a menu allowing the user to make a start the p..

  What information to save-process moves from running to idle

When a process moves from running to idle, the state of the machine has to be saved. Obviously this cannot mean the whole state, as there would be no place to save it. Just what information has to be saved?

  The board game scrabble

The board game Scrabble works by assigning points to wooden tiles that are marked with printed letters, and are arranged as interlocking words on a Scrabble board.

  Creating a payoff table for decision

Amy decided to select the best option which will minimize her total 36-month cost. Difficult is that Amy is not sure how many miles she will drive over next three years. Create payoff table for Amy's decision.

  Determining accurate formula using undetermined coefficients

Determine a more accurate formula for f'(t) using method of undetermined coefficients. Let's say the formula is of the form f'(t)= Af(t + 2h) + Bf(t + h) - Bf(t - h) - Af(t - 2h).

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd