User Account

All Pages

Define dna replication-transcription and translation

Assignment Help Biology
Reference no: EM132496770

1. Define DNA replication, transcription and translation.

2. A double stranded DNA molecule has the following sequence:

5' ATCCGGATGTTGCCGGAATGCTGGCGATGACGT 3'

3' TAGGCCTACAACGGCCTTACGACCGCTACTGCA 5'

Answer the following questions?

a. Draw the first 10 newly synthesized bases during DNA replication (ignore the origin of replication).

b. What is the mRNA sequence (ignore the promoter region)?

c. What is the enzyme involved in transcription?

After you predict the mRNA sequence,

d. Where is the start codon in translation?

e. What are the amino acids that will be translated?

f. Where is the stop codon?

g. How many amino acids are made?

Reference no: EM132496770

Questions Cloud

Benefits and possible harmful effects of genetic modificatio : Discuss the potential benefits and possible harmful effects of genetic modification
Explain the role of the line management : Explain the role of the line management (supervisors) in the accomplishment of each the following Human Resource Management practices
Should inflict western values on the society : Is your opinion of Nike any different now after viewing this video? Would this change your buying behavior with respect to Nike products?
Describe the inheritance of abo blood groups : Describe the inheritance of ABO blood groups including the example of the possible outcomes of a homozygous blood group
Define dna replication-transcription and translation : 1. Define DNA replication, transcription and translation. 2. A double stranded DNA molecule has the following sequence:
Identify stage of labor and appropriate nursing intervention : Based on the vaginal assessment, identify the stage of labor and appropriate nursing interventions for this stage of labor. Explain how the nurse determined.
Discuss about the french vs american health care system : How French Speaking Countries (you can pick one or two) have handled the COVID-19 crisis. Compare it with how it is handled here in the US. Discussion
Describe the two laws of inheritance put forward : Describe the two laws of inheritance put forward by Gregor Mendel.
How poor leadership might affect the outcome of the case : As a future leader in the field of health care administration, you may face many chronic health threats to various systems. As you work to combat these threats.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd