Create the mrna sequence, A section of the E. coli genome

Create the mrna sequence

Reference no: EM1394890

The sequence below is a section of the E. coli genome that encodes the pheM protein. Write out and label: A) the reverse complement, B) the mRNA sequence, and c) the resulting amino acid sequence using three letter code designations. Indicate what would happen if the underlined Thymine base is mutated to a Cytosine?
AGCAATGAATGCTGCTATTTTCCGCTTCTTTTTTTACTTTAGCACCTGAATCCAGG

Reference no: EM1394890

Questions Cloud

Determine linear order of genes on the chromosome : In D. Melanogaster cherub wings(ch), black body (b) and cinnabar eyes (cn) result from recessive alleles tht are all located on chromosome 2. A homozygous wild-type fly was mated with a cherub, black, and cinnabar fly.

Survey-obesity in children : Prepare an analysis of your survey. Determine if you have used the appropriate measures to research your business problem, and identify the level of measurement being used for each of your survey questions.

Write journal and opinion for article : Write 1-2 page journal for article. Each paragraph can be ten-fifteen sentences. Must include author, name of article, date of publication, source, and short description of overall information.

Conduct a one-tailed hypothesis test : Conduct a one-tailed hypothesis test given the information below. A certain brand of Green Energy light bulbs was advertised as having an average illumination life-span of 2,500 hours. A random sample of 50 bulbs burned out with a mean life-span o..

Create the mrna sequence : A section of the E. coli genome that encodes the pheM protein. Write out and label: the reverse complement, the mRNA sequence.

Description of levels of measurement : The following survey questions have been established for a medical errors and patient safety business research paper:

What is the limiting reactant after adding : How many moles of S8 are needed to make 0.600 moles of SF4? S8 + 8 Cl2 = 8 SCl2 ; 3 SCl2 + 4 NaF = SF4 + S2Cl2 + 4 NaCl

Contribute to the field of biomedical engineering : Over the last several years, situations in my household were quite difficult. Animosity between my mother and my sibling were a hallmark of this difficult time, and the constant yelling and fighting made it difficult for me to focus on my school s..

Addressing business problem : Prepare a 10-13-question survey to gather primary data regarding your selected problem statement. Please note that you will not administer this survey as part of this assignment.

User Account

All Pages