Create the mrna sequence

Assignment Help Biology
Reference no: EM1394890

The sequence below is a section of the E. coli genome that encodes the pheM protein. Write out and label: A) the reverse complement, B) the mRNA sequence, and c) the resulting amino acid sequence using three letter code designations. Indicate what would happen if the underlined Thymine base is mutated to a Cytosine?
AGCAATGAATGCTGCTATTTTCCGCTTCTTTTTTTACTTTAGCACCTGAATCCAGG

Reference no: EM1394890

Questions Cloud

Determine linear order of genes on the chromosome : In D. Melanogaster cherub wings(ch), black body (b) and cinnabar eyes (cn) result from recessive alleles tht are all located on chromosome 2. A homozygous wild-type fly was mated with a cherub, black, and cinnabar fly.
Survey-obesity in children : Prepare an analysis of your survey. Determine if you have used the appropriate measures to research your business problem, and identify the level of measurement being used for each of your survey questions.
Write journal and opinion for article : Write 1-2 page journal for article. Each paragraph can be ten-fifteen sentences. Must include author, name of article, date of publication, source, and short description of overall information.
Conduct a one-tailed hypothesis test : Conduct a one-tailed hypothesis test given the information below. A certain brand of Green Energy light bulbs was advertised as having an average illumination life-span of 2,500 hours. A random sample of 50 bulbs burned out with a mean life-span o..
Create the mrna sequence : A section of the E. coli genome that encodes the pheM protein. Write out and label: the reverse complement, the mRNA sequence.
Description of levels of measurement : The following survey questions have been established for a medical errors and patient safety business research paper:
What is the limiting reactant after adding : How many moles of S8 are needed to make 0.600 moles of SF4? S8 + 8 Cl2 = 8 SCl2 ; 3 SCl2 + 4 NaF = SF4 + S2Cl2 + 4 NaCl
Contribute to the field of biomedical engineering : Over the last several years, situations in my household were quite difficult. Animosity between my mother and my sibling were a hallmark of this difficult time, and the constant yelling and fighting made it difficult for me to focus on my school s..
Addressing business problem : Prepare a 10-13-question survey to gather primary data regarding your selected problem statement. Please note that you will not administer this survey as part of this assignment.

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd