Containing all the genes in the dna sequence

Assignment Help C/C++ Programming
Reference no: EM13164606

Write a program that will read in a genome and display all the genes in the genome. Your program must do the
following:

  • Include a function named genes that will take two arguments: a string containing a DNA sequence

as described above plus an integer reference parameter, and return a dynamically-allocated array of
strings containing all the genes in the DNA sequence. Each string in the array will contain a unique
gene. The number of elements in the array should be exactly equal to the number of genes in the
sequence and the number of genes found should be returned using the function's reference argument.

  • Include a main function that will solicit a DNA sequence string from the user, call the genes function

to obtain all the genes in the sequence and print each one on the console display.

[Hint: there are many ways to do this, but you may find it easiest to perform two "passes" of the sequence. A
first pass to determine how many genes there are, and a second to construct the individual gene strings]

Example:
Enter a DNA sequence: TCATGTGCCCAAGCTGACTATGGCCCAATAGCG
Gene 1 TGCCCAAGC
Gene 2 GCCCAA

Individual genes are substrings of a genome delineated by 3-element start and stop codons. Genes begin with
the start codon ATG and end with one of the following 3 stop codons: TAG, TAA or TGA. Note that start codons
can appear anywhere in the string, followed by a series of 3-element codons and ending with a stop codon.
Note that genes are multiples of 3 in length and do not contain any of the triples ATG, TAG, TAA or TGA.

Reference no: EM13164606

Questions Cloud

Write a turing machine that takes as input : Write a Turing machine that takes as input the unary representation of any two different numbers, separated by a blank, and halts with the representation of the larger of the two numbers on the tape.
The code to implement a state diagram to recognize : The code to implement a state diagram to recognize one form of the comments of the C-based programming languages, those begin with /* and end with */.
Comparison of 3 mobile operating systems in user interface : comparison of three mobile operating systems in terms of user interface, functionality, application support and platform presence.
Use the getint and getintwithinrange methods : Use the getInt and getIntWithinRange methods to validate that each score ranges from 1 through 100 and add code that discards any extra entries at the prompt that asks if you want to enter another score to the application below.
Containing all the genes in the dna sequence : As described above plus an integer reference parameter, and return a dynamically-allocated array of strings containing all the genes in the DNA sequence. Each string in the array will contain a unique
A company wants to see a printout : A company wants to see a printout of the gross payroll for each of its 7 departments. The output should be a list of the seven departments and the total gross payroll (rate times hours) for each department
Reads from the external file input.txt : Program that reads from the external file input.txt, counts the letters in every word, replaces the word by that number, and then writes the numbers to an external file output.tx
Design a program that extends the definition of the class : Design a program that extends the definition of the class JFrame to display a window on the screen. Name your class PropertyTax1, title your window "Calculation of Property Taxes," set the window's width to 400 pixels and height to 300 pixels, and te..
Program to keep track of the participants in a triathlon : Create a program to keep track of the participants in a triathlon. Your program will keep track of the times in three events: Running, Swimming, and Biking. Your program will calculate who is the winner in the Male category and the Female category..

Reviews

Write a Review

C/C++ Programming Questions & Answers

  Create program that uses functions and reference parameters

Create program that uses functions and reference parameters, and asks user for the outside temperature.

  Write a program using vectors and iterators

Write a program using vectors and iterators that allows a user to maintain a personal list of DVD titles

  Write the code required to analyse and display the data

Calculate and store the average for each row and column. Determine and store the values for the Average Map.

  Write a webservices application

Write a webservices application that does a simple four function calculator

  Iimplement a client-server of the game

Iimplement a client-server version of the rock-paper-scissors-lizard-Spock game.

  Model-view-controller

Explain Model-View-Controller paradigm

  Design a nested program

How many levels of nesting are there in this design?

  Convert celsius temperatures to fahrenheit temperatures

Write a C++ program that converts Celsius Temperatures to Fahrenheit Temperatures.

  Evaluate and output the value in the given base

Write C program that will input two values from the user that are a Value and a Base with which you will evaluate and output the Value in the given Base.

  Design a base class shape with virtual functions

Design a base class shape with virtual functions

  Implementation of classes

Implementation of classes Chart and BarChart. Class barChart chould display a simple textual representation of the data

  Technical paper: memory management

Technical Paper: Memory Management, The intent of this paper is to provide you with an in depth knowledge of how memory is used in executing, your programs and its critical support for applications.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd