Containing all the genes in the dna sequence

Reference no: EM13164606

Write a program that will read in a genome and display all the genes in the genome. Your program must do the
following:

Include a function named genes that will take two arguments: a string containing a DNA sequence

as described above plus an integer reference parameter, and return a dynamically-allocated array of
strings containing all the genes in the DNA sequence. Each string in the array will contain a unique
gene. The number of elements in the array should be exactly equal to the number of genes in the
sequence and the number of genes found should be returned using the function's reference argument.

Include a main function that will solicit a DNA sequence string from the user, call the genes function

to obtain all the genes in the sequence and print each one on the console display.

[Hint: there are many ways to do this, but you may find it easiest to perform two "passes" of the sequence. A
first pass to determine how many genes there are, and a second to construct the individual gene strings]

Example:
Enter a DNA sequence: TCATGTGCCCAAGCTGACTATGGCCCAATAGCG
Gene 1 TGCCCAAGC
Gene 2 GCCCAA

Individual genes are substrings of a genome delineated by 3-element start and stop codons. Genes begin with
the start codon ATG and end with one of the following 3 stop codons: TAG, TAA or TGA. Note that start codons
can appear anywhere in the string, followed by a series of 3-element codons and ending with a stop codon.
Note that genes are multiples of 3 in length and do not contain any of the triples ATG, TAG, TAA or TGA.

Reference no: EM13164606

Questions Cloud

Write a turing machine that takes as input : Write a Turing machine that takes as input the unary representation of any two different numbers, separated by a blank, and halts with the representation of the larger of the two numbers on the tape.

The code to implement a state diagram to recognize : The code to implement a state diagram to recognize one form of the comments of the C-based programming languages, those begin with /* and end with */.

Comparison of 3 mobile operating systems in user interface : comparison of three mobile operating systems in terms of user interface, functionality, application support and platform presence.

Use the getint and getintwithinrange methods : Use the getInt and getIntWithinRange methods to validate that each score ranges from 1 through 100 and add code that discards any extra entries at the prompt that asks if you want to enter another score to the application below.

Containing all the genes in the dna sequence : As described above plus an integer reference parameter, and return a dynamically-allocated array of strings containing all the genes in the DNA sequence. Each string in the array will contain a unique

A company wants to see a printout : A company wants to see a printout of the gross payroll for each of its 7 departments. The output should be a list of the seven departments and the total gross payroll (rate times hours) for each department

Reads from the external file input.txt : Program that reads from the external file input.txt, counts the letters in every word, replaces the word by that number, and then writes the numbers to an external file output.tx

Design a program that extends the definition of the class : Design a program that extends the definition of the class JFrame to display a window on the screen. Name your class PropertyTax1, title your window "Calculation of Property Taxes," set the window's width to 400 pixels and height to 300 pixels, and te..

Program to keep track of the participants in a triathlon : Create a program to keep track of the participants in a triathlon. Your program will keep track of the times in three events: Running, Swimming, and Biking. Your program will calculate who is the winner in the Male category and the Female category..

User Account

All Pages