Construct a simple xml schema

Assignment Help Basic Computer Science
Reference no: EM13536174

Construct a simple XML schema that describes a tutor. Include the tutor's last name, first name, phone, email address, and the certification date as child elements of the TUTOR element.

Reference no: EM13536174

Questions Cloud

Explain compounds has electrovalent : Which of the following compound or compounds has electrovalent, covalent, co-ordinate as well as hydrogen bond. Explain the reasons for each making appropriate use of diagrams wherever necessary.
Determine how much power does it deliver to the clock : A grandfather clock is powered by the descent of a 4.40-kg weight. If the weight descends through a distance of 0.750 m in 3.00 days, how much power does it deliver to the clock
Classifying events as asset source : Classifying events as asset source - Receive cash from customers for services rendered
Calculate the torque exerted on the trap door by the rope : A trap door, of length and width 2.00 m, is held open at an angle of 65.0° with respect to the floor. what is the torque exerted on the trap door by the rope
Construct a simple xml schema : Construct a simple XML schema that describes a tutor. Include the tutor's last name, first name, phone, email address, and the certification date as child elements of the TUTOR element.
Explain what happens when traces of unreacted magnesium : What happens when traces of unreacted magnesium metal in a reaction tube when acid is added, after completion of a grignard synthesis of bromobenzene
Obtain the angle of the first-order diffraction : X rays diffract from a crystal in which the spacing between atomic planes is 0.200nm. What is the angle of the first-order diffraction
Explain convert propyne into an electrophile : Starting with 2 different samples of propyne, show how you can make 2-methyl-pent-3-yn-2-ol (condensed formula (CH3)2C(OH)C=CCH3 ). In other words, you can convert propyne into a nucleophile, and convert propyne into an electrophile, and react the..
Compute what is the mass of the block of ice : A dock worker applies a constant horizontal force of 76.0 N to a block of ice on a smooth horizontal floor. The frictional force is negligible. What is the mass of the block of ice

Reviews

Write a Review

Basic Computer Science Questions & Answers

  How much of program-s time slice can be spent waiting

Desired data to rotate around to the read/write head, how much of a program's time slice can be spent waiting for a read operation from a disk to take place?

  Goals of system monitoring urban weather and pollution

What goals would you have for the system besides monitoring urban weather and pollution? What legal and ethical concerns should you understand prior to deploying the network?

  Write the algorithm/logic for computing following problem

Given the dimensions of a crate (side 1, side 2, and side 3), find the largest surface area it can provide when used as a table.

  Identify and describe any potential ethical issues

Identify and describe any potential ethical issues that could arise in connection with the new architecture.

  First instruction executed if we start machine with counter

Suppose the memory cells at addresses 00 through 02 contain the following bit patterns. What would be the first instruction executed if we start the machine with its program counter containing 00?

  Function that uses a switch statement

To locate nearest numbered cross street for a given avenue address, the following algorithm can be used: cancel last diget of the address, divide by two,

  Compare with that of a general pda

c) Could the Mark 100 or Mark 200X process this string: 0n1n? How about 1n0m1m0n? Succinctly justify you answer. d) How does the power of the Mark 100 and Mark 200X compare with that of a general PDA? Succinctly justify your answer.

  Write a condition-controlled while loop

Write a condition-controlled while loop that allows the user to enter the calories they burned. Stop looping when the user enters a negative number. Display the Total and Average number of calories burned.

  Demonstrate ability to integrate and apply information

demonstrate ability to integrate and apply information from various topics and to apply understanding and knowledge to a practical situation.

  Tools to perform project management processes

Describe in scholarly detail the tools and techniques that are used for prforming project management processes.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Write a complete c++ program that reworks your cellular bill

Write a complete C++ program that reworks your Cellular Bill calculation program from Chapter 4. Give your source file a meaningful name, such as CellBillFun.cpp.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd