Compute the gross margin ratio both with and without

Reference no: EM13584317

Use the following selected data from Success Systems' income statement for the three months ended March 31, 2014, and from its March 31, 2014, balance sheet to complete the requirements below: computer services revenue, $25,160; net sales (of goods), $18,693; total sales and revenue, $43,853; cost of goods sold, $14,052; net income, $18,686; quick assets, $100,205; current assets, $105,209; total
assets, $129,909; current liabilities, $875; total liabilities, $875; and total equity, $129,034.

Required
1. Compute the gross margin ratio (both with and without services revenue) and net profit margin ratio (round the percent to one decimal).
2. Compute the current ratio and acid-test ratio (round to one decimal).
3. Compute the debt ratio and equity ratio (round the percent to one decimal).
4. What percent of its assets are current? What percent are long term (round the percent to one decimal)?

Reference no: EM13584317

Questions Cloud

Andrew orr and victoria graham formed a partnership : andrew orr and victoria graham formed a partnership dividing income as follows annual salary allowance to orr of 28000.

The ebit of a firm is 300 the tax rate is 35 the : the ebit of a firm is 300 the tax rate is 35 the depreciation is 20 capital expenditures are 60 and the increase in net

Question a political strategist believes that at least 58 : question a political strategist believes that at least 58 of voters in a certain state support his candidate. he then

David oliver and umar ansari with capital balances of 28000 : david oliver and umar ansari with capital balances of 28000 and 35000 respectively decide to liquidate their

Compute the gross margin ratio both with and without : use the following selected data from success systems income statement for the three months ended march 31 2014 and from

Why are frameshift mutations insertions and deletions more : 1. the following series of nucleotide bases forms part of a dna molecule tacttatgacacaggaggacta convert this string of

The company declared dividends of 6000 on preferred stock : burke company shows the following condensed income statement information for the year ended december 31 2010income

1 what did the astronomer edwin hubble discover about : 1 what did the astronomer edwin hubble discover about galaxies in the 1920s?2 what formula is used to calculate the

Give an example of a researchstatistic study that you : give an example of a researchstatistic study that you encountered this week in your life outside of this course. this

User Account

All Pages