Comparing dna and rna, Compare DNA and RNA with regard to

Comparing dna and rna

Reference no: EM1394440

Question: Compare DNA and RNA with regard to their structure, function, location, and activity. Ho do these molecules differ with regard to the polymerases used to synthesize them?

Question: AN E. coli transcript with the first two nucleotides 5'-AG-3' is initiated from the segment of double-stranded DNA in Figure 5.A below:
a. Where is the transcription start site?
b. What are the approximate locations of the regions that bind the RNA polymerase homoenzyme?
c. Does transcription elongation proceed toward the right or left?
d. Which DNA strand is the template strand?
e. Which DNA strand is the RNA-coding strand?
Figure 5.A
5'-TAGTGTATTGACATGATAGAAGCACTCTTACTATAATCTCAATAGCTAACG-3'
3'-ATCACATAACTGTACTATCTTCGTGAGAATGATATTAGAGTTATCGATGC -5'

Reference no: EM1394440

Questions Cloud

Illustrate what are two example of persuasion : ritical thinking covers fallacies also rhetoric. Illustrate what are two e.g. of persuasion which are not valid arguments according to the text? Explain why are these invalid arguments.

Extravagant and exotic childhood experiences : Do you think it was his “extravagant and exotic childhood experiences” that led Buddha to question, or was it the Four Sights? Or, did the Four Sights so contradict the lifestyle that he was living that he began to question life?

Random sample distriction : In a nationwide study directed by UMUC Teaching Hospital, 780 persons with stable heart disease were treated. Half of the subjects were treated with drugs and half underwent bypass surgery.

Develop a marketing plan for the new product : Which of the following components of the political environment should Norma be LEAST concerned with as her industry begins to develop a marketing plan for the new product.

Comparing dna and rna : Compare DNA and RNA with regard to their structure, function, location, and activity. Ho do these molecules differ with regard to the polymerases used to synthesize them?

Calculating p-vlaue for average duration of unemployment : From a random sample we know that the average duration of unemployment in a low developed region A is 147 days (with standard deviation sA = 32 days and nA = 230 unemployed).

Explain why is strategy important to business : Be sure to use your reading this week as a resource. You are encouraged also to use the Library databases also the Internet as additional resources.

Explain why the author begins with this : Marks Gospel begins with John the Baptist proclaiming Jesus is the Son of God and the adult Jesus being baptised. Explain why the author begins with this, rather than with the birth of Jesus.

Explain the methods utilized in needs assessment : Explain the methods utilized in needs assessment, and give examples. Using your own words, sum-up the process for learner analysis.

User Account

All Pages