User Account

All Pages

Change in the protein synthesized

Assignment Help Business Management
Reference no: EM132553200

Based on the following information:

a. DNA template card #5:

DNA: TACCTTTGTACCATATCTATT

mRNA: AUGGAAACAUGGUAUAGAUAA

Codon: AUG-GAA-ACA-UGG-UAU-AGA-UAA

Amino Acid Sequence: Met-Glu-Thr-Trp-Tyr-Arg-Stop

b. DNA template card # 11:

DNA: TACCTGTGTACCATATCTATT

mRNA: AUGGACACAUGGUAUAGAUAA

Codon: AUG-GAC-ACA-UGG-UAU-AGA-UAA

Amino Acid Sequence: Met-Asp-Thr-Trp-Tyr-Arg-Stop

c. DNA template card # 12:

DNA: TAC-CAT-GTA-CCA-TAT-CTA-CT

mRNA: AUG-GUA-CAU-GGU-AUA-GAU-GA

Codon: AUG-GUA-CAU-GGU-AUA-GAU-GA

Amino Acid Sequence: Met-Val-His-Gly-Ile-Asp

d. DNA template card # 13:

DNA: TACCCTTTGTACCATATCTACT

mRNA: AUGGGAAACAUGGUAUAGAUGA

Codon: AUG-GGA-AAC-AUG-GUA-UAG-AUG-A

Amino Acid Sequence: Met-Gly-Asn-Met-Val-Stop

e. DNA template card # 14:

DNA: TACTTTGTACCATATCTATC

mRNA: AUGAAACAUGGUAUAGAUAG

Codon: AUG-AAA-CAU-GGU-AUA-GAU-AG

Amino Acid Sequence: Met-Lys-His-Gly-Ile-Asp

Answer these questions:

a. Did the mutation in card 11 result in a change in the protein synthesized?

b. Did the mutation in card 12 result in a change in the protein synthesized?

c. What type of mutation occurred in cards 13 and 14?

d. Would the mutations that occurred in cards 13 and 14 result in a change in the protein synthesized?

Reference no: EM132553200

Questions Cloud

Determine return on investment was : For 2025, Aberdeen's return on sales was 10% and its investment turnover was 2.0. What Return on investment for 2025 was?
What does muscular function have to do with sense of vision : 1. What does muscular function have to do with the sense of vision? 2. In what way is the structure of the ear similar to that of the eye?
List 4 functions for proteins : What would happen if you gave a patient an IV of pure water? In which way would the water be moving?
What a transfer of products between two divisions should : What a transfer of products between two divisions should take place if it?increases awareness within the company of activity in the various divisions.
Change in the protein synthesized : Would the mutations that occurred in cards 13 and 14 result in a change in the protein synthesized?
What was the st john division eva : What was the St. John's Division EVA for 2022? St. John's Division has a required rate of return of 15%. The weighted average cost of capital
Identify the characteristics of hypoglycemia : A 25-year-old healthy female patient complained of dizziness and shaking 1 hour after eating a large, heavy-carbohydrate meal.
Estimate the allowance for bad debts : Describe each method used to estimate the allowance for bad debts. Do you think business employ the methods described in the text and why?
Compute the overhead cost per unit for each product : Compute the overhead cost per unit for each product under the proposed activity based costing. Production is 400,000 units of Standard

Reviews

Write a Review

Business Management Questions & Answers

  Three-step binomial tree

(a) What is the value of a 6-month European call option with a strike price of $52 using a three-step binomial tree? (b) Draw the tree mark the value of the option on each nod of the tree.

  Dynamically allocated array of ints

Write a void function called transformArray that takes two parameters - a reference to a pointer to a dynamically allocated array of ints

  Processes of configuration management

In general, processes of configuration management do not include...50 o ...identification and documentation of system or item characteristics. o ...controlling changes to these characteristics in an integrative fashion. o ...documenting and au..

  Designing the mental environment

Identify two things that are considered when designing the mental environment and describe how they affect individuals in the workplace.

  Discuss the pros and cons of csr

For this post discuss the pros and cons of CSR, but with a twist. Students whose last name ends in A - L will post their initial response to the discussion post from a Pro perspective.

  Evaluate the attributes and themes of a specific leader

Evaluate the attributes and themes of a specific leader in order to determine the characteristics of successful leadership and articulate individual examples of the practice of modeling the way.

  Question regarding the measuring unemployment

(Measuring Unemployment) Suppose that the US noninstitutional adult population is 230 million and the labor force participation rate is 67 percent. a. What would be the size of the us labor force

  Health code violations by local health inspectors

In a newspaper, they publish a weekly list of restaurants that have been cited for health code violations by local health inspectors.

  Company manufacturing operations overseas

The CEO just presented a proposal that involves moving your company's manufacturing operations overseas.

  Explain appropriate form of ownership for your new business

Explain the most appropriate form of ownership for your new business (assuming your current financial situation). Include two references outside the textbook.

  When there are excessive nursing students graduated

When there are excessive nursing students graduated, the demand curve for the labor market will shift downward (to the right).

  Common-size statement value of wilmington

What is the common-size statement value of Wilmington's interest expense?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd