Campus food service case study

Assignment Help Business Management

Reference no: EM1361871

Campus Food Service Case Study

Case Study:
A student is asked to "minimize" accidents in a campus kitchen and that her grade depends on it. She was asked to glaze over accidents involving employee injuries and some OSHA issues. Provide examples that support why this student should not intentionally lie about these safety and health issues that were clearly violated.

The report should include three focal points on why proper reporting of accidents is warranted: avoiding potential lawsuits, government audits by agencies such as the Occupational Safety & Health Administration (OSHA) may result in fines if accidents are inaccurately documented and due diligence in providing a safe work environment for employees - providing benefits due if an accident does occur. The solution clearly explains each of these points and how they benefit both the campus, as the employer, and the student employees.

Reference no: EM1361871

Questions Cloud

Case for and against drug testing : Case For and Against Drug Testing - Is this a good thing or is this something that violates the 14th amendment?

Identify position-indicate what pattern is found in thread : Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

Experiences of lower back pain : A 36 year old female has a 75 degree ROM in her hamstring and experiences lower back pain. How does this affect her movement? Design a program to help her reduce her lower back pain.

Calculate the bond price : Consider an America Off Line thirty year, semiannual bond. It is issued at par today. Interest rates remain at 6 percent for five years, and then GRADUALLY, over 5 years rises to 7%,

Campus food service case study : Provide examples that support why this student should not intentionally lie about these safety and health issues that were clearly violated.

At what value of z does e have its maximum value : What is the frequency of the small axial oscillations that the electron will undergo if it is free along the z-axis near the origin.

Barriers to identifying problems in the market : Explain three barriers that might cause the marketing executive to poorly identify the problem(s). An illustrative example in this context should be included for each barrier.

Finding a flexibility test : Find a flexibility test (V sit-n-reach, modified sit-and-reach, back-saver sit and reach, or back scratch test) and write up a lab report regarding the test, and include an introduction, methodology, results and conclusion.

Non-egocentric mind : Explain the logic of the non-egocentric mind. What are attributes of this mind, and how does it usually think? Present ideas about how you can expand your ability to think rationally.

User Account

All Pages