Calculate pairwise distances between sequences

Assignment Help Python Programming
Reference no: EM132636501

Outbreak investigation using Machine Learning.

You are given a data set consisting of DNA sequences (the file is availablehere) of the same length. Each DNA sequence is a string of characters from the alphabet ‘A','C','T','G', and it represents a particular viral strain sampled from an infected individual.Your goal is to write a code that helps to identify transmission clusters corresponding to outbreaks.

The sequences should be considered as feature vectors and characters - as features. The data set is stored as a fasta file, which is essentially a text file thathas the following form:
>Name of Sequence1
AAGCACAGGATGTAATGGTGGGGCCGACCGCCTATTATTCTGATGATTACTTGAGGCCCTCGGAGAGGAAGGGG
>Name of Sequence2
AAGCACAGGATGTAATGGTGGGGCCGACCGCCTATTATTCTGATGATTACTTGAGGCCCTCGGAGAGGAAGGGG
>Name of Sequence3
AAGCACAGGATGTAATGGTGGGGCCGACCGCCTATTATTCTGATGATTACTTGAGGCCCTCGGAGAGGAAGGGG
.....
Here each line starting with ‘>' symbol contains the name of a sequence followed by the sequence itself in the next line.

You may proceed as follows:
1) Read sequences from the file.
2) Calculate pairwise distances between sequences. Use Hamming distance: it is the number of positions at which the sequences are different.
3) Project the sequences in 2-D spaceusing Multidimensional Scaling (MDS) based on Hamming distance matrix.
4) Plot the obtained 2-D data points. Estimate the number of clusters K by visual inspection.
5) Use k-means algorithm to cluster the 2-D data points.
You may use library functions to read data from the file and perform MDS.For multidimensional scaling in python.
K-means clustering should be implemented from scratch. Your submission should contain:
• The code of your script
• Visualization plots for MDS with different clusters highlighted in different colors.
Please do not hesitate to ask questions.

Attachment:- Outbreak investigation using Machine Learning.zip

Reference no: EM132636501

Questions Cloud

Address the memo to all mid-level managers : Address the memo to all mid-level managers and above at your company - explain the new process that the employees can expect. Outline the way that reviews
Explain relationship between policies and security plans : Explain the relationship between policies and security plans. Identify potential policy needs, noting Justin's privacy policy,
How about an ecommerce presence : Do presentation layers add an attack surface to the enterprise? How about an eCommerce presence?
Mobile phones with emphasis on auditing system : Our task in conference is to discuss, mobile phones (including smart phones and tablets). with an emphasis on an auditing system for such phones/devices
Calculate pairwise distances between sequences : Calculate pairwise distances between sequences. Use Hamming distance: it is the number of positions at which the sequences are different
Discussing application of this course to work environment : Discussing the application of this course to your work environment. How will you apply the skills acquired from this course to your job?
Determine what rate of interest is implicit in the agreement : Determine what rate of interest is implicit in the agreement. Provide the journal entries for Bronzed Aussie Ltd for the years ending 30 June 2020 and 2021
Prepare the July entry for Ayayai Corporation : Ayayai Corporation purchased Young Company by paying $257,800 cash and issuing a $139,000 note payable, Prepare the July entry for Ayayai Corporation
Implementation of physical and environmental controls : Write a evaluation of implementation of physical and environmental controls for the new EDMS. How to control access to document at each stage of its life cycle.

Reviews

Write a Review

Python Programming Questions & Answers

  Write a python program to implement the diff command

Without using the system() function to call any bash commands, write a python program that will implement a simple version of the diff command.

  Write a program for checking a circle

Write a program for checking a circle program must either print "is a circle: YES" or "is a circle: NO", appropriately.

  Prepare a python program

Prepare a Python program which evaluates how many stuck numbers there are in a range of integers. The range will be input as two command-line arguments.

  Python atm program to enter account number

Write a simple Python ATM program. Ask user to enter their account number, and print their initail balance. (Just make one up). Ask them if they wish to make deposit or withdrawal.

  Python function to calculate two roots

Write a Python function main() to calculate two roots. You must input a,b and c from keyboard, and then print two roots. Suppose the discriminant D= b2-4ac is positive.

  Design program that asks user to enter amount in python

IN Python Design a program that asks the user to enter the amount that he or she has budget in a month. A loop should then prompt the user to enter his or her expenses for the month.

  Write python program which imports three dictionaries

Write a Python program called hours.py which imports three dictionaries, and uses the data in them to calculate how many hours each person has spent in the lab.

  Write python program to create factors of numbers

Write down a python program which takes two numbers and creates the factors of both numbers and displays the greatest common factor.

  Email spam filter

Analyze the emails and predict whether the mail is a spam or not a spam - Create a training file and copy the text of several mails and spams in to it And create a test set identical to the training set but with different examples.

  Improve the readability and structural design of the code

Improve the readability and structural design of the code by improving the function names, variables, and loops, as well as whitespace. Move functions close to related functions or blocks of code related to your organised code.

  Create a simple and responsive gui

Please use primarily PHP or Python to solve the exercise and create a simple and responsive GUI, using HTML, CSS and JavaScript.Do not use a database.

  The program is to print the time

The program is to print the time in seconds that the iterative version takes, the time in seconds that the recursive version takes, and the difference between the times.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd