Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Outbreak investigation using Machine Learning.
You are given a data set consisting of DNA sequences (the file is availablehere) of the same length. Each DNA sequence is a string of characters from the alphabet ‘A','C','T','G', and it represents a particular viral strain sampled from an infected individual.Your goal is to write a code that helps to identify transmission clusters corresponding to outbreaks.
The sequences should be considered as feature vectors and characters - as features. The data set is stored as a fasta file, which is essentially a text file thathas the following form:>Name of Sequence1AAGCACAGGATGTAATGGTGGGGCCGACCGCCTATTATTCTGATGATTACTTGAGGCCCTCGGAGAGGAAGGGG>Name of Sequence2AAGCACAGGATGTAATGGTGGGGCCGACCGCCTATTATTCTGATGATTACTTGAGGCCCTCGGAGAGGAAGGGG>Name of Sequence3AAGCACAGGATGTAATGGTGGGGCCGACCGCCTATTATTCTGATGATTACTTGAGGCCCTCGGAGAGGAAGGGG.....Here each line starting with ‘>' symbol contains the name of a sequence followed by the sequence itself in the next line.
You may proceed as follows:1) Read sequences from the file.2) Calculate pairwise distances between sequences. Use Hamming distance: it is the number of positions at which the sequences are different.3) Project the sequences in 2-D spaceusing Multidimensional Scaling (MDS) based on Hamming distance matrix.4) Plot the obtained 2-D data points. Estimate the number of clusters K by visual inspection. 5) Use k-means algorithm to cluster the 2-D data points.You may use library functions to read data from the file and perform MDS.For multidimensional scaling in python. K-means clustering should be implemented from scratch. Your submission should contain:• The code of your script• Visualization plots for MDS with different clusters highlighted in different colors.Please do not hesitate to ask questions.
Attachment:- Outbreak investigation using Machine Learning.zip
Without using the system() function to call any bash commands, write a python program that will implement a simple version of the diff command.
Write a program for checking a circle program must either print "is a circle: YES" or "is a circle: NO", appropriately.
Prepare a Python program which evaluates how many stuck numbers there are in a range of integers. The range will be input as two command-line arguments.
Write a simple Python ATM program. Ask user to enter their account number, and print their initail balance. (Just make one up). Ask them if they wish to make deposit or withdrawal.
Write a Python function main() to calculate two roots. You must input a,b and c from keyboard, and then print two roots. Suppose the discriminant D= b2-4ac is positive.
IN Python Design a program that asks the user to enter the amount that he or she has budget in a month. A loop should then prompt the user to enter his or her expenses for the month.
Write a Python program called hours.py which imports three dictionaries, and uses the data in them to calculate how many hours each person has spent in the lab.
Write down a python program which takes two numbers and creates the factors of both numbers and displays the greatest common factor.
Analyze the emails and predict whether the mail is a spam or not a spam - Create a training file and copy the text of several mails and spams in to it And create a test set identical to the training set but with different examples.
Improve the readability and structural design of the code by improving the function names, variables, and loops, as well as whitespace. Move functions close to related functions or blocks of code related to your organised code.
Please use primarily PHP or Python to solve the exercise and create a simple and responsive GUI, using HTML, CSS and JavaScript.Do not use a database.
The program is to print the time in seconds that the iterative version takes, the time in seconds that the recursive version takes, and the difference between the times.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd