Biological function methylases perform in bacteria

Assignment Help Biology

Reference no: EM1383674

Question: Determine what biological function do methylases perform in bacteria? What adaptive value do they have for a bacterium?

4. The following DNA is part of a gene that codes for a polypeptide of at least seven amino acids:

3' caattgattagtcagtcaatt gat 5'

5' gttaactaatcagtcagttaa cta 3'

a. Which strand includes an Open Reading Frame? Top (T) or Bottom (B)

b. Is this protein generated from the 1st, 2nd or 3rd frame?

c. Give the complimentary mRNA sequence that would be transcribed from this gene; label the 5' & 3' ends.

d) Give the seven amino acids that would be translated from the correct message; label the C & N ends.

Reference no: EM1383674

Questions Cloud

What are new charge on spheres : What are new charge on spheres - Two insulated charge Cu spheres A and B OF IDENTICAL size have charge qa and -3qa

Find the concentration in mg/ml : A 2.5 mg/ml stock solution was diluted as described in the table below and then the absorbance of each dilution was estimated and presented in the table given below.

The evolution of mobile communications example smartphones : With the evolution of mobile communications example smartphones and tablet computers) and warehouse automation and MHE

Security countermeasures against dos attacks : Assume a future where security countermeasures against DoS attacks are much more widely implemented than at present. In this future network, antispoofing and directed broadcast filters are widely deployed.

Biological function methylases perform in bacteria : Determine what biological function do methylases perform in bacteria? What adaptive value do they have for a bacterium?

Hrm has transitioned over the last couple of decades : HRM has transitioned over the last couple of decades from back office support to strategic partner.Review some major trends that have impacted HRM over the last twenty years

Vehicle delay due to queuing : Vehicles begin to arrive at a toll booth at 850 am with an arrival rate of x(t) = 4.1 + .01t (with t in min and x(t) in veh /min.) The toll booth opens at 9am and processes vehicles at a rate of 12 per minute throughout the day. Assuming D/D/1 que..

Significant means for assessing health of existing network : Explain some of the most significant means for assessing health of existing network. Which do you believe is most significant, and explain why?

Transnational solution suggests that technical and marketing : Organizing for Worldwide Effectiveness: the Transnational Solution" suggests that technical and marketing functions be integrated within each subsidiary of any organization. What are the strengths of such an organization? What are the weaknesses o..

User Account

All Pages