At what value of z does e have its maximum value

Reference no: EM1361870

Q. A uniform circular ring of charge Q= 5.60 microCoulombs and radius R= 1.30 cm is located in the x-y plane, centered on the origin.

What is the magnitude of the electric field E at point P, located at z= 2.40 cm?
5.942×107 N/C

Consider other locations along the positive z-axis. At what value of z does E have its maximum value?

What is the maximum value of E on the z-axis?

If z << R then E is proportional to z. (You should verify this by taking the limit of your expression for E for z << R.) If you place an electron on the z-axis near the origin it experiences a force Fz= -kz, where k is a constant. Obtain a numerical value for k.

What is the frequency of the small axial oscillations that the electron will undergo if it is released along the z-axis near the origin?

Reference no: EM1361870

Questions Cloud

Identify position-indicate what pattern is found in thread : Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

Experiences of lower back pain : A 36 year old female has a 75 degree ROM in her hamstring and experiences lower back pain. How does this affect her movement? Design a program to help her reduce her lower back pain.

Calculate the bond price : Consider an America Off Line thirty year, semiannual bond. It is issued at par today. Interest rates remain at 6 percent for five years, and then GRADUALLY, over 5 years rises to 7%,

Campus food service case study : Provide examples that support why this student should not intentionally lie about these safety and health issues that were clearly violated.

At what value of z does e have its maximum value : What is the frequency of the small axial oscillations that the electron will undergo if it is free along the z-axis near the origin.

Barriers to identifying problems in the market : Explain three barriers that might cause the marketing executive to poorly identify the problem(s). An illustrative example in this context should be included for each barrier.

Finding a flexibility test : Find a flexibility test (V sit-n-reach, modified sit-and-reach, back-saver sit and reach, or back scratch test) and write up a lab report regarding the test, and include an introduction, methodology, results and conclusion.

Non-egocentric mind : Explain the logic of the non-egocentric mind. What are attributes of this mind, and how does it usually think? Present ideas about how you can expand your ability to think rationally.

What was the car''s initial velocity : A charge of -3.95 nC and a charge of -5nC are separated by a distance of 30.0 cm. Find the position at which a third charge of +8.00 nC can be placed so that the net electrostatic force on it is zero. How many cm from the -3.95 nC charge and how m..

User Account

All Pages