Assume you are high-potential rising-star manager

Assignment Help Biology
Reference no: EM13848383

A Case of Morphing Legal Charges in China

Paper instructions:
A Case of Morphing Legal Charges in China pg. 80
Textbook: Kinicki, A., & Fugate, M. (2012). Organizational Behavior: Key Concepts, Skills & Best Practices (5th ed.). New York, NY: McGraw-Hill/Irwin.

Part A.
Assume you are high-potential, rising-star manager within Rio Tinto and are offered a position at a company facility in China. Because China is the company's biggest customer, an assignment there is likely to advance your career.
1. Would you take the position? If yes, then explain why. Also describe what you might do to prevent a situation similar to the one above.
2. If no, then explain why you made this choice. Also explain how you would communicate this decision to the manager who offered you the position.

Part B.
Assume you are the CEO of Rio Tinto.
3. Considering only the information above, what changes if any would you make to company policy related to doing business in China.

Part C.
Additional information came to light after the trial. Just before the executives were detained, the Chinese steel industry association complained about inflated iron prices and blamed Rio Tinto and others for a breakdown in iron ore contract talks. Additionally, "Rio Tinto scrapped plans to accept a $19.5 billion investment from Chinalco, one of China's biggest state-owned mining groups."
4. Based on this new information, do your answers to questions 1, 2, and 3 change? Explain why or why not.

Reference no: EM13848383

Questions Cloud

Briefly name and describe the laws and regulations specific : Amy is seven years old and loves to play with dolls. In fact, she has more than 20 Barbie dolls and lots of clothes and accessories, including three cars, a house with furniture, and an airplane. Mattel, the manufacturer of Barbie, also sells many ot..
Rank the tools in order of importance to the job requirement : If each of the positions below, if you were required to choose two major financial tools to focus on and become expert at, which would you choose? Explain your answers. Support your answers by providing at least one example of why your chosen tools a..
Open savings account : A friend asks whether he should open a savings account that pays 5 percent interest compounded semiannually or one that pays 5 percent interest compounded daily. What would you tell him or her, and why?
Find the optimal solution using graphical solution technique : Precision Machinists makes two grades of gears for industrial machinery: standard and heavy duty. The process requires two steps. Step-1 takes 8 minutes for the standard gear and 10 minutes for the heavy duty. How many of each gear should be made eac..
Assume you are high-potential rising-star manager : Part A.Assume you are high-potential, rising-star manager within Rio Tinto and are offered a position at a company facility in China. Because China is the company's biggest customer, an assignment there is likely to advance your career.1. Would you t..
Measure risk relies on probability distribution : This will be a real challenge, but it should be an interesting challenge. Much of the way we measure risk relies on probability distribution (the bell curve as shown on page 425). For many things in life, and business, this is perfectly valid, but fo..
Find the ratio of the height attained by the two balls : Pankaj and Sudhir are playing with two different balls of masses m and 2m respectively. If Pankaj throws his ball vertically up and Sudhir at an angle θ, both of them stay in our view for the same period. Find the ratio of The height attained by th..
What should the brand equity building focus on : Based on all of the information above, write an online branding proposal for Premier Portraits. Who specifically should Premier Portraits target with the new branding message? What product should Premier Portraits really offer to this market? What va..
How do energy and nutrients move through ecosystems : How do energy and nutrients move through ecosystems? Indicate whether each is recycled. Define trophic levels and explain their involvement/role in energy movement.

Reviews

Write a Review

Biology Questions & Answers

  What would be the expected phenotypes

The genes for mahogany eyes and ebony body are approximately 25 map units apart on chromosome 3 in Drosophila. Assume that a mahogany-eyed female was mated to an ebony- bodied male and that the resulting F1 phenotypically wild-type females were ma..

  Which of these is not a characteristic of carbon

Which of these is not a characteristic of carbon.

  How organisms have changed the atmosphere on earth

Explain how organisms have changed the atmosphere on earth

  What is cystic fibrosis

What is cystic fibrosis? Tell me the genetics behind CF and specifically how that genetic abnormality results in the problems associated with CF.

  Define how the axonal membrane potential is restored

define how the axonal membrane potential is restored. Describe how resting ionic distributions are maintained.

  Find percent change in the area of mold growth

Steve is in the midst of his Microbe experiment. He is increasing mold on a piece of peach. After five days in the baggie, the mold covers 88 square millimeters of the peach surface.

  Which phyla have fewer than 3 germ layers

Which phyla have fewer than 3 germ layers? Which phyla have 3 germ layers?

  What are the names and order of the connection inside

What are the names and order of the connection inside desmosomes, through the membrane and into the ECM?

  Why are frameshift mutations insertions and deletions more

1. the following series of nucleotide bases forms part of a dna molecule tacttatgacacaggaggacta convert this string of

  Describe how the methods of treating mental illness have

1. discuss how the methods of treating mental illness have changed over the years. how is mental health viewed now

  Carbon dioxide is significant in our atomosphere as it is

carbon dioxide is important in our atomosphere because it is required for photosynthesis and traps some heat keeping

  Q1 oceans receive materials from land primarily as runoff

q1. oceans receive materials from land primarily as runoff from rivers. which of the statements is true regarding the

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd