Advise jackie on the sale of the farm house

Assignment Help Business Law and Ethics
Reference no: EM133208925

Question - Jackie has been really happy with your advice so far. She is now dealing with another legal issue regarding some properties that she owns. She recently sold her farm house in Spotsylvania and moved to a house closer to her office in Manassas. She used the same title company for both the sale and purchase of the two properties. She recently received a summons to appear in the general district court in Spotsylvania regarding a claim that she did not have the right to sale the farm house in Spotsylvania. She inherited the farm house from her mother who she believed own the house. The law suit alleges that her mother only had a life estate in the property. She believed that her mother owned the house which had been in their family for three generation. She wants to understand what is a life estate. She then wants to know if the house that has passed three generation could be a life estate.

The second issue she is having is regarding a rental property that she owns. She has a tenant that installed three items in the home. The lease has expired and she is now concerned that the tenant will take out the items and effect the value of the home. They removed and replaced a chandelier in the dining room. They also installed a gas stove which required the installation of a gas pipe which upon removal would leave a pipe and large whole when removed. The last item is a refrigerator.

Advise Jackie on the sale of the farm house.

Advise Jackie on the status of the items in her rental property and whether or not she can keep them.

Reference no: EM133208925

Questions Cloud

Discuss whether the decision to build the factory : Discuss whether the decision to build the factory at Kampung Melur is considered as ethical or unethical by applying Utilitarianism and Kantian Theory
Explain the evidence for evolution : Explain the evidence for evolution? What evidence did Darwin use to explain his theory of evolution? What do we know today that we didn't know then
Discuss the main dimensions for classification : Discuss the main dimensions for classification of networked e-business. Discuss the main business directions and operations related to networked e-business
What amino acid sequence will be generated : What amino acid sequence will be generated based on this strand of DNA? Use Figure 16.6 in your text book 3TACCGCTTACTGAAAGTTATT
Advise jackie on the sale of the farm house : The second issue she is having is regarding a rental property that she owns. Advise Jackie on the sale of the farm house
Apply the relevant cogdon facts to the case you discussed : Discuss the facts from that case, the court's reasoning, and its ruling. Apply the relevant Cogdon facts to the case you discussed
Explain what strict liability means in criminal law : Explain what strict liability means in criminal law. Support your explanation with a primary authority or a secondary scholarly source from Westlaw
Has tech savvy corp made sufficient : Question - An exciting new company, Tech Savvy Corp., designs and builds printer consoles. Has Tech Savvy Corp made sufficient
Discuss the facts from that case, the court''s reasoning : Discuss the facts from that case, the court's reasoning, and its ruling. Apply the relevant Cogdon facts to the case you discussed

Reviews

Write a Review

Business Law and Ethics Questions & Answers

  Sharon screams attract the attention of darry

Business Torts and Ethics paper help You own University Heights Apartments, a business that rents primarily to students. One evening, your tenant Sharon is attacked by an intruder who forces the lock on the sliding glass door of her ground-floor apar..

  Courts the history occurred in key facts

The courts the history occurred in Key facts - include relevant facts only - Issue - reason for the matter being in court Holding - this is the court's decision

  What is the irac analysis method for given case

What is the irac analysis method for this case: robert john barclayjr., respondent, v. TECHNO-DESIGN, INC., Appellant, et al.,

  Concept of community corrections

Which of the following was not an innovation initially developed by John Augustus? The concept of community corrections is best understood as a goal. That goal clearly is to

  Explain whether a party can withdraw a mistaken offer

BLO1105: Business Law Research Assignment. Assignment Topic: Contracts created by electronic means. Explain how offer and acceptance may take place between the parties and Explain whether a party can withdraw a mistaken offer

  What if the result is the release of a violent criminal

Do you believe that a defense attorney should be required to zealously represent a client who has admitted guilt to the lawyer?

  Explain how do handle conflict with coworkers

Explain how do you handle conflict with coworkers? What is your greatest strength and what is your greatest weakness? What questions do you have for us?

  Determining the liability of the government

Identify and describe generally the law(s) applicable to determining the liability of the government and its employees for injuries caused by negligence in:

  Why natalie and brothers have chosen different paths in life

Select at least two different, contemporary theories that would apply to the case. Employ the theories to explain why Natalie and her brothers have chosen different paths in life.

  How does an intentional tort differ from negligencehow does

how does an intentional tort differ from negligence?provide examples of both negligence and an intentional tort.how

  What are the rights and remedies of cora cole as executor

Immediately after acquiring this information, Mrs. Cole made demand upon Ames and Bell for one-third of the profit of $200,000. They rejected her demand. What are the rights and remedies, if any, of Cora Cole as executor?

  Describe how these three branches are supposed to interact

What are the duties and responsibilities of each branch of the federal government? Describe how these three branches are supposed to interact. How effectively do you feel the three branches interact with each other today

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd