Reference no: EM13846641
1. A sequence in FASTA format consists of a header line starting with a ">" sign, followed by a sequence identifier (GenBank Accession number, or clone name), and one or more lines of the sequence itself.
Write a Java program to first prompt the user for a sequence identifier, such as "Enter a clone name
Then prompt for the DNA sequence. The program should print out a FASTA format sequence to the screen. An example output is listed below:
>bi617a01
GCATGGCGTAAATTGCCCGTACGCTTAA
2. To develop a Java program to prompt the user to enter a piece of DNA sequence in upper case letter (G, C, A, or T). Using a for loop and the charAt() method of the String class to check each character of the entered sequence, and if the sequence contains non-DNA sequence letter(s), print out the sequence and a message says that the DNA sequence entered contains invalid letters. If what entered is a true DNA sequence (with only G, C, A, or T), print out just the sequence. (2 points)
3. Design a Java program that asks the user to input a series of 10 integers, and then determines and prints the largest integer you entered. Your program should use at least the following three variables:
counter: A counter to count to 10 (i.e, to keep track of how many numbers have been input and to determine when all 10 numbers have been processed).
number: The integer most recently input by the user.
largest: The largest number found so far.
|
What is the definition of a non-busy
: What is the definition of a non-busy waiting BoundedBuffer? I have to implement one for my Operating Systems course but cannot find any resources on non-busy waiting BBs, only on busy waiting BBs
|
|
Dee fektiv is concerned that too many forms
: Dee Fektiv is concerned that too many forms are being filled out incorrectly. She feels that about 10 percent of forms have an error. a. How large a sample size should Dee use to be 99% certain that she will be within 0.02?
|
|
Firm in perfect competition
: A firm in a perfectly competitive market has the following total cost function: STC = 20 + 6Q - 1.12Q 2 + 0.09Q3, where Q is the firm's output (in 000s). Market price is $7.
|
|
What is happening to total domestic gas production
: Where does NSW get most of its natural gas supplies from up to now? What is happening to total domestic gas production in Australia and Describe the structural change that is taking place in the Australian gas market.
|
|
A sequence in fasta format consists of a header line
: 1. A sequence in FASTA format consists of a header line starting with a ">" sign, followed by a sequence identifier (GenBank Accession number, or clone name), and one or more lines of the sequence itself. Write a Java program to first prompt the user..
|
|
Describes how the objectives you wrote address
: describes how the objectives you wrote address the characteristics of a basic ELL level and accounts for the theoretical language acquisition principles mentioned in your required reading.
|
|
Write a program in c which takes the (x, y) coordinate
: Write a program in C which takes the (x, y) coordinates of three points on the x-y plane as the input and outputs the area of the triangle formed by the three points. More specically, the program prompts the user to enter six float typed numbers fro..
|
|
Definition of professional communication
: One-page single-spaced rationale of your definition of professional communication. Make a cogent argument for a definition of professional communication. Warrant that argument through expert opinion from course readings. Address and respond to counte..
|
|
Forward exchange rates and annual interest rates
: Suppose that you are given the information about the spot exchange rate, annual interest rates, and the forward exchange rates between the US Dollar against Japanese Yen and Turkish lira at the given dates in Table 2. Suppose that a US investor wi..
|