A scientist has discovered a human gene from the cancer

Assignment Help Biology
Reference no: EM13455150

A scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene was determined as written below: 3'gacacgtacgagcctggacaccttaagagcgggctcggaacactggccccgattgacac5'

(a) study the nucleotide sequence of the template strand and write sense strand (showing direction) of the gene.

(b) write down the mrna produces from this gene.

(c) how many amino acids will be present in the protein product of this gene.

(d) write amino acid sequence of the polypeptide

Reference no: EM13455150

Questions Cloud

What kind of selection and what is the parasitic : usually only whole populations of a species evolve by natural selection. explain the special type of selection that
Suppose that youre a risk adverse manager in the industry : assume that you are a risk adverse manager in an industry experiencing rapid technological innovations. which of the
Review the virtual organization riordan manufacturing : describe at least four sustainability strategies. review the virtual organization riordan manufacturing which can be
Assume you describe the concept of the inflation tax to a : write a 700-1000 word paper in which you address the questions below. also do your best to format your work
A scientist has discovered a human gene from the cancer : a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene
Based upon plan preparation how would one assess the : based upon plan preparation how would one assess the impacts of organizational strengths and weaknesses related to
Describe how you have incorporated this leaders feedback : 1.explore the central michigan university competencies model2.identify you current strengths and weaknesses as a leader
Describe the astronomy facilities at the alma array in : describe the astronomy facilities at the alma array in chile. assess the range of applications of this array and the
Define risk and how it affects strategy planning process in : define risk and how it affects the strategy planning process. in relation to innovation sustainability and the global

Reviews

Write a Review

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd