A scientist has discovered a human gene from the cancer

Reference no: EM13455150

A scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene was determined as written below: 3'gacacgtacgagcctggacaccttaagagcgggctcggaacactggccccgattgacac5'

(a) study the nucleotide sequence of the template strand and write sense strand (showing direction) of the gene.

(b) write down the mrna produces from this gene.

(d) write amino acid sequence of the polypeptide

Reference no: EM13455150

Questions Cloud

What kind of selection and what is the parasitic : usually only whole populations of a species evolve by natural selection. explain the special type of selection that

Suppose that youre a risk adverse manager in the industry : assume that you are a risk adverse manager in an industry experiencing rapid technological innovations. which of the

Review the virtual organization riordan manufacturing : describe at least four sustainability strategies. review the virtual organization riordan manufacturing which can be

Assume you describe the concept of the inflation tax to a : write a 700-1000 word paper in which you address the questions below. also do your best to format your work

A scientist has discovered a human gene from the cancer : a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene

Based upon plan preparation how would one assess the : based upon plan preparation how would one assess the impacts of organizational strengths and weaknesses related to

Describe how you have incorporated this leaders feedback : 1.explore the central michigan university competencies model2.identify you current strengths and weaknesses as a leader

Describe the astronomy facilities at the alma array in : describe the astronomy facilities at the alma array in chile. assess the range of applications of this array and the

Define risk and how it affects strategy planning process in : define risk and how it affects the strategy planning process. in relation to innovation sustainability and the global

User Account

All Pages