8-bit registers are there in the intel 80x86 cpu design

Assignment Help Basic Computer Science
Reference no: EM13166736

  1. In total, how many 8-bit registers are there in the Intel 80x86 CPU design presented in class? Name one of these 8-bit registers.
  2. In total, how many 16-bit registers are there in the Intel 80x86 CPU design presented in class? Name one of these 16-bit registers.
  3. In total, how many 32-bit registers are there in the Intel 80x86 CPU design presented in class? Name one of these 32-bit registers.
  4. Name an important difference between the registers that have three-letter names and the ones that have two-letter names.
  5. Way back in 1981, IBM released the first generation of its Personal Computers with an Intel 8088 CPU chip inside. From that time forward to today, one of Intel's most important design goals has been to provide backward compatibility in the interest of preserving the investment of its existing customer base. Intel hardware designers have continually ensured that programs written for its older chips continue to run, unmodified, on its newer chips. This original 8088 CPU has only 16-bit registers. Even today, on the Pentium 80x86 CPUs, these same registers still exist. Name them.
  6. In addition to having so few registers, Intel's CPU registers overlap on top of one another. If your code sets bit 14 in EDX, there are two other registers whose bits get altered. Name these registers and which bits of these registers that will get altered.
  7. In addition to have so few registers, Intel's CPU registers overlap on top of one another. If your code sets bit 7 in AX, there will be two other register whose bits get altered. Name these registers and which bits of these registers that will get altered.

 

 

Reference no: EM13166736

Questions Cloud

Our model assumes that the arrival distribution of customers : In the McBurgers simulation, our model assumes that the arrival distribution of customers is the same throughout the entire day. Do you think this is a realistic assumption? If not, explain how you could modify the model to make it a better repres..
Write a python program that computes the mean, median, mode : How to write a python program that computes the mean, median, and mode?
How many shares of common stock : How many shares of common stock are issued and how many shares of common stock are outstanding?
Explain a buffer solution is prepared by dissolving : A buffer solution is prepared by dissolving 1.50g each of benzioc acid C6H5CO2H and sodium benzoate NaC6H5CO2 in 150.0mL of solution.
8-bit registers are there in the intel 80x86 cpu design : In total, how many 8-bit registers are there in the Intel 80x86 CPU design presented in class? Name one of these 8-bit registers.
Draw pictures of the list names afte : Draw pictures of the list names after each line of the following code. Show the head pointer of the list, and the values and next pointers of every node. Draw pointers as arrows, and the null pointer as a slash or X. You may assume the list is sin..
Implement a game called bunko-poker : Implement a game called Bunko-Poker. The gameplay is an easily programmed version of the popular game Yahtzee. Your program will make use of the supplied static functions Dice.roll() and, in cases where you might need the string ordered, Dice.ordered..
Is problem solving easier and more effective in solving : Is problem solving easier and more effective in solving business problems without information systems or with? (justify your position)
Develop should take a message given as a command : The program you develop should take a message given as a command line argument and append it to a file (also specified on the command line). The file should have no permissions, both before and after the message is appended. Of course, the file sh..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Explain hardware implementations of intelligent agents

There are hardware implementations of intelligent agents. Determine the literature instances of intelligent agents as software. Compare and contrast two implementations.

  Responsibilities of job when designing digital portfolio

Do you think that your digital portfolio should depend on the job, title, or industry you are planning or working on getting into? Do task and responsibilities of a specific job matter when designing your digital portfolio?

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Explain the concept of supply chain management

Explain the concept of supply chain management. Although R/Way offers services rather than products, could that concept apply to the design of R/Way's new system? If so, how?

  Determining most effective it projects

Not sure what will suit their requirements in achieving better organization between branches by updating their information systems. What will you suggest they do to find out most effective IT projects?

  Describe operational-tactical and strategic reporting

Describe operational, tactical and strategic reporting. How do requirements drive reporting system inputs requirements and write down the ramifications of ignoring user requirements.

  The progress report you will describe

The progress report you will describe your progress and analysis of the unfinished solution. At this time you should be able to take stock of your skills and abilities and match them against the project requirements.

  Create implementation plan to analyze options

Boardman plans to hire Smith Systems Consulting to help them analyze their options and to create the implementation plan.

  Write program to enter two separate numbers

Write a program which would permit a user to enter two separate numbers and choose one of four mathematical operations (add, subtract, multiply, divide).

  Write organizational factors for benefits of new information

Write three organizational factors which can prevent a firm in completely realizing benefits of new information system, and give examples for each.

  Finding counterexample-algorithm based on greedy strategy

Determine a counterexample for following algorithm based on greedy strategy.

  Research details of ad of current web site or magazine

Pick a current web site or magazine ad for a complete, working computer system, including computer, monitor, keyboard, and software, together with extra devices such as a mouse or printer

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd