User Account

All Pages

1 what did the astronomer edwin hubble discover about

Assignment Help Science
Reference no: EM13584314

1) What did the Astronomer Edwin Hubble discover about galaxies in the 1920's?

2) What formula is used to calculate the Hubble Parameter? Tell what each thing in the formula is.

4) Are the distances to galaxies given by Hubble's Law very accurate measurements like a spectroscope, a rough estimate like the distance to the distance to the Pleiades or something in between like the distances measured in the parallax lab?

5) Extra Credit: What else (other than the distance to far-away galaxies) can we learn from using Hubble's Law?

Reference no: EM13584314

Questions Cloud

David oliver and umar ansari with capital balances of 28000 : david oliver and umar ansari with capital balances of 28000 and 35000 respectively decide to liquidate their
Compute the gross margin ratio both with and without : use the following selected data from success systems income statement for the three months ended march 31 2014 and from
Why are frameshift mutations insertions and deletions more : 1. the following series of nucleotide bases forms part of a dna molecule tacttatgacacaggaggacta convert this string of
The company declared dividends of 6000 on preferred stock : burke company shows the following condensed income statement information for the year ended december 31 2010income
1 what did the astronomer edwin hubble discover about : 1 what did the astronomer edwin hubble discover about galaxies in the 1920s?2 what formula is used to calculate the
Give an example of a researchstatistic study that you : give an example of a researchstatistic study that you encountered this week in your life outside of this course. this
Johnson inc owns control over kaspar inc johnson reports : johnson inc. owns control over kaspar inc johnson reports sales of 400000 during 2013 while kaspar reports 250000.
Using the internet or strayer databases research the : each state within the united states has its own unique judicial selection process within its own court system.using the
Large corporation acquired and placed in service the : large corporation acquired and placed in service the following 100 business-use assets. large did not elect sec. 179

Reviews

Write a Review

Science Questions & Answers

  Journal of pharmaceutical sciences

This journal is a scientific publication of Indian Pharmaceutical Association and highlights various bright points of it.

  Optical fibres

This document discuss about the main attributes and characteristics of optical fibres.

  Micro organisms

This project report reveals the fact and proves a specific objective mentioned to be studied upon.

  Describing histology of an organ

The discussion of the technique should include a literature review on the evolution of the technique.

  Interpret the sensitivity of mammography

Calculate and interpret the sensitivity of mammography. Diagnostic test with Sensitivity 50%, Specificity 50% and prevalence 50%. Crude mortality rate. Damage caused by motor vehicle accidents.

  Discuss the role that science plays in your daily life

Role that science plays in your daily life and Integrity, Intensity, Innovation, and involvement in scientific field

  Prepare a flexible budget gator divers

Prepare a Flexible Budget Gator Divers is a company that provides diving services such as underwater ship repairs to clients in the Tampa Bay area.

  Neurological disorders

Designing a neuroprosthesis for the neurological disorders

  Complexity of cell surfaces

Lipid rafts provide another example of the complexity of cell surfaces in both their structural character and biologic functionality. Please explain the nature of these structures and their functionality.

  Exploratory activity on bird beaks

Describe how natural selection and evolution are demonstrated by this activity

  Spatial and temporal variation of heat content in the upper

In this study the temporal and spatial variation of heat content in the upper 70m layer of the Arabian Sea was for a period of 1991 to 2008 have been attempted.

  Earthquake databases

Earthquake Databases

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd